ID: 910430428

View in Genome Browser
Species Human (GRCh38)
Location 1:87154655-87154677
Sequence CAGTCTGGGCAGAGGGGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 579
Summary {0: 1, 1: 0, 2: 5, 3: 43, 4: 530}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910430428_910430436 -4 Left 910430428 1:87154655-87154677 CCCACTCCCCTCTGCCCAGACTG 0: 1
1: 0
2: 5
3: 43
4: 530
Right 910430436 1:87154674-87154696 ACTGGTTCAAGCCGCCACCCTGG No data
910430428_910430441 16 Left 910430428 1:87154655-87154677 CCCACTCCCCTCTGCCCAGACTG 0: 1
1: 0
2: 5
3: 43
4: 530
Right 910430441 1:87154694-87154716 TGGACTGATGAGAATATGCCAGG No data
910430428_910430442 17 Left 910430428 1:87154655-87154677 CCCACTCCCCTCTGCCCAGACTG 0: 1
1: 0
2: 5
3: 43
4: 530
Right 910430442 1:87154695-87154717 GGACTGATGAGAATATGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910430428 Original CRISPR CAGTCTGGGCAGAGGGGAGT GGG (reversed) Intronic
900018698 1:171917-171939 AAGGCTGGCCAGAGGGGAGGTGG + Intergenic
900048956 1:530512-530534 AAGGCTGGCCAGAGGGGAGGTGG + Intergenic
900071187 1:772336-772358 TAGGCTGGCCAGAGGGGAGGTGG + Intergenic
900081992 1:865364-865386 CAGGGTGGGCAGAGAGGAGAGGG - Intergenic
900088207 1:908638-908660 GAGACAGGGGAGAGGGGAGTAGG + Intergenic
900226263 1:1534924-1534946 CAGCTTGGGCGGAGGGGAGGGGG - Intergenic
901012583 1:6209957-6209979 CAGGCTGTGCAGAGGTGAGTTGG + Exonic
901561171 1:10072084-10072106 CCCTCTGGGGAGAGGTGAGTGGG - Exonic
901882824 1:12204108-12204130 CAGAAGGGGCAGAGGGGAGAGGG - Intronic
902112964 1:14098600-14098622 CAGTCTGGGCAGAGGGATGCTGG - Intergenic
902232369 1:15036227-15036249 CAGGCAGGGCAGAGGGGGATGGG - Intronic
904163632 1:28538722-28538744 CACTCTGGGCAGAGCAGAGCAGG + Intronic
904494584 1:30879480-30879502 CTTTCTGGGCAGAGGGGAGCTGG - Intronic
904602309 1:31680461-31680483 CAGGCTGGGCCCAGAGGAGTGGG - Intronic
904634668 1:31870576-31870598 CAGGCTGGGCAGTGGTGACTGGG + Intergenic
905457839 1:38100679-38100701 CAGTCTGGGAAGAGGGGCCTTGG + Intergenic
905975062 1:42168567-42168589 CAGACTAGGCAGAGGGGCTTGGG - Intergenic
906191346 1:43901371-43901393 CAGTCTGTCCAGTGGGAAGTAGG - Intronic
906264514 1:44418082-44418104 CCGTCTGAGCAGAAGAGAGTGGG + Intronic
906488308 1:46248093-46248115 CAGACTGGGCGGAGTGGAGTGGG - Exonic
907134088 1:52122770-52122792 CTGTCTGGGCAGACAGCAGTAGG - Intergenic
907328276 1:53654903-53654925 CAGTCTCTGAAGAGGGAAGTGGG + Intronic
907572965 1:55500763-55500785 TAGTCTGGGGAGATGGAAGTTGG + Intergenic
907876940 1:58499221-58499243 CAGGCTGGGGATCGGGGAGTAGG + Intronic
908383867 1:63621909-63621931 CATTCTTGACAGAGGGCAGTTGG + Intronic
910430428 1:87154655-87154677 CAGTCTGGGCAGAGGGGAGTGGG - Intronic
911069422 1:93820758-93820780 ACCTCTGGGAAGAGGGGAGTTGG - Intronic
911114839 1:94236860-94236882 CAGTCAGGGCAGGTGGGAGCGGG + Intronic
911178782 1:94843088-94843110 CAGGCTGGGCATAGGGGAAGAGG + Intronic
911209105 1:95120929-95120951 CAGGCTGGGCGGAGGGGGATTGG + Intronic
914330716 1:146668090-146668112 CAGCCTGTCCAGATGGGAGTTGG + Intergenic
915282331 1:154830956-154830978 AGGTCTGGGCAGAGGGGAACTGG + Intronic
915524517 1:156467720-156467742 CCCTATGGGGAGAGGGGAGTGGG - Intronic
915631885 1:157159144-157159166 CAGCCTGGGAAGAGAGGATTGGG - Intergenic
915720663 1:157983039-157983061 CAGTGTGGACAGAGGGCAGCGGG - Intergenic
916073076 1:161183067-161183089 CAGTGTAGGCTGAGGGGAGTTGG - Intergenic
916088189 1:161286522-161286544 GAGGCTGGGAAGAGGGGAGATGG - Intergenic
916193553 1:162201962-162201984 CAGTGTGTTCAGAGGAGAGTTGG + Intronic
916864074 1:168837236-168837258 CAGACTGGGCAGCGGGGTGGAGG - Intergenic
917568402 1:176235895-176235917 CAGTATGGGAAGAGGGGTGATGG + Intergenic
918132735 1:181643789-181643811 CATTCTTGGCAGCGGGGAGATGG + Intronic
918170316 1:181990056-181990078 TAGTATGTGCTGAGGGGAGTGGG + Intergenic
919466556 1:197927207-197927229 GAGTGTGGGCAGTGGGGAGCTGG + Intronic
919803686 1:201368296-201368318 GAGAATGGGCAGCGGGGAGTGGG + Intronic
920044519 1:203124802-203124824 CACTGTGGGCAGAGGTGGGTGGG - Intronic
920347725 1:205317450-205317472 CAGGCTGGGCAGAGTGGGGGTGG + Intronic
920398219 1:205661483-205661505 CAGCCTCAGCAGACGGGAGTGGG - Intronic
921674964 1:217966607-217966629 AATTCTGGGCAGAGGAGGGTGGG - Intergenic
922106548 1:222517785-222517807 AAGGCTGGCCAGAGGGGAGGTGG + Intergenic
922473641 1:225891152-225891174 CTGTCTGGGCTGAGGAGGGTGGG + Intronic
923104072 1:230840989-230841011 CTGTGTGGGCAGTGGAGAGTAGG - Intronic
923273736 1:232379381-232379403 CAGCCTGGGCAGCTGGGAGATGG - Intergenic
923546514 1:234927479-234927501 CAGGCTGGGTGGAGGGCAGTGGG - Intergenic
923701065 1:236301072-236301094 AATTCTGGGCAGAAGAGAGTGGG + Intergenic
923720866 1:236465473-236465495 AAATCTGGGCAGTGGGGACTTGG - Intronic
924348732 1:243095351-243095373 AAGGCTGGCCAGAGGGGAGGTGG + Intergenic
924374522 1:243391408-243391430 CAGTCTCGGGAGATGAGAGTAGG + Intronic
1065198759 10:23293475-23293497 CAGTGTGGGCAGATGGCAGAAGG - Intronic
1066034483 10:31467897-31467919 CAGTCTGGGCACAGGTGGTTTGG + Intronic
1066244605 10:33570384-33570406 CAGTGTGGGCAGTGGGGACCAGG + Intergenic
1066727628 10:38409552-38409574 AAGGCTGGCCAGAGGGGAGGTGG - Intergenic
1067055215 10:43045986-43046008 CCGCCTGGGAAGAAGGGAGTGGG + Intergenic
1067168719 10:43886166-43886188 GAGTGTGGGCAGAGGGCAGGTGG + Intergenic
1067220790 10:44342922-44342944 CAGTCTGGGCAGTGCAGAGTAGG - Intergenic
1067228075 10:44388180-44388202 CAGGCCAGGCAGAGGGGGGTAGG - Intergenic
1067687479 10:48475899-48475921 CAGTGTGGCCAGAGCAGAGTGGG - Intronic
1067811235 10:49428832-49428854 CCTCCTGGGCAGAGGGTAGTAGG + Intergenic
1069680770 10:70283813-70283835 CGGTCCGGGCAGAGGTGAGCAGG + Intergenic
1069720183 10:70544807-70544829 CAGGCTGTGCCCAGGGGAGTAGG - Intronic
1069841295 10:71341039-71341061 CAGTCTGGGGAGAGGAGAGGCGG + Intronic
1069965175 10:72109357-72109379 CAGTCAGTGGAGAGGGGACTTGG - Intronic
1070368091 10:75755769-75755791 CAGGCTGTGCAGTGGGGAGCAGG + Intronic
1070721501 10:78760340-78760362 CAGTCTGGTCAGGGTGGAATCGG - Intergenic
1070842269 10:79495403-79495425 CAGTGGGGGCAGAGGGGAAGCGG + Intergenic
1073145999 10:101282401-101282423 GTCTCTGGGCAGAGGGGAATTGG - Intergenic
1073500169 10:103929741-103929763 CGGTCTTGGCTGAGGGGAGGCGG - Intergenic
1074532865 10:114309006-114309028 CAGTCTGCTCACAGGGGTGTTGG + Intronic
1074619006 10:115098290-115098312 CAGTCAGGGCAGAGGAAAGGAGG - Intronic
1074763898 10:116686718-116686740 CAGTGTGGGAAGAGGGGACAAGG - Intronic
1075795565 10:125117149-125117171 GAGTCGGGGCAGAGGAGGGTTGG - Intronic
1076408990 10:130232598-130232620 CAGCCTGGGCAGACAGGAGTTGG + Intergenic
1076869224 10:133185174-133185196 CAGTGTGTGCAGTGTGGAGTAGG + Intronic
1076869226 10:133185197-133185219 CAGTGTGTGCAGTGTGGAGTAGG + Intronic
1076869236 10:133185335-133185357 CAGTGTGTGCAGTGTGGAGTAGG + Intronic
1076869242 10:133185404-133185426 CAGTGTGTGCAGTGTGGAGTAGG + Intronic
1076869247 10:133185473-133185495 CAGTGTGTGCAGTGTGGAGTAGG + Intronic
1076975300 11:167113-167135 AAGGCTGGCCAGAGGGGAGGTGG + Intergenic
1077191213 11:1256577-1256599 CAGGATGGGCAGTGGGGAGCAGG - Intronic
1077284525 11:1759779-1759801 CAGGCTGAGCAGGTGGGAGTGGG - Intronic
1077414777 11:2420011-2420033 CTGTCTGGGCAGAGTGGTGAAGG - Intronic
1077536063 11:3124856-3124878 GAAGCTGGGCAGAGGGGAATTGG - Intronic
1077603016 11:3586908-3586930 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1078050807 11:7963348-7963370 CCCACTGGCCAGAGGGGAGTTGG - Exonic
1078355850 11:10630859-10630881 CACTCTTGGCACAGGGGAGGGGG - Intronic
1078427270 11:11261938-11261960 CAGTCAGGGGAGACGGGAGGAGG + Intergenic
1078602574 11:12746842-12746864 CAGGCTGGGCTGAGGGCTGTGGG + Intronic
1079317580 11:19422224-19422246 CAGTCTGGGGGGCGGGGAGCGGG + Intronic
1080763366 11:35273748-35273770 CAGGCTGGGCAGGGGAGAATGGG + Intronic
1081740465 11:45435972-45435994 CAGTCTGGGCTGGGTGCAGTGGG - Intergenic
1081979807 11:47259276-47259298 CGGTCTGGGCTCAGGGGAGAGGG - Intronic
1082843377 11:57707712-57707734 CCATCTGGACAGAGGAGAGTTGG - Intronic
1083174131 11:60938793-60938815 AAGTCAGGGCAGAGTGCAGTGGG - Intronic
1083470611 11:62881507-62881529 CCGTCTGGGGACAGGGGAGGGGG - Intronic
1083626201 11:64073324-64073346 CAGGATGGGCATGGGGGAGTGGG - Intronic
1083657678 11:64237522-64237544 CAGCGTGGGCAGAGGGGCCTGGG - Exonic
1083700872 11:64476985-64477007 CAGCCTCAGCAGAGGGGGGTAGG - Intergenic
1083879918 11:65543318-65543340 CAGTTGGGGCATAGGGGCGTGGG - Intronic
1084047070 11:66575241-66575263 CAGCCTGGGGAGCGGGGAGGAGG - Intergenic
1084258896 11:67961446-67961468 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1084435121 11:69135031-69135053 CAGGCTGGACAGAGAGGAGGAGG - Intergenic
1084813851 11:71633732-71633754 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1085237655 11:75027454-75027476 CAGTTTAGGCAGAGGGGCGGGGG - Intergenic
1086161777 11:83729743-83729765 CAGTCTGGGCAAAGTTGAATTGG + Intronic
1086497671 11:87421103-87421125 CAGTCTTGGCAGCAGAGAGTGGG - Intergenic
1087242743 11:95797827-95797849 CTGACTGGGCAGAGGGTGGTCGG + Intronic
1087899111 11:103620892-103620914 CAGTCCTGGCAGAGTGGAGAAGG + Intergenic
1089780585 11:120870620-120870642 CAGTCTGGACAAAGGGTACTGGG + Intronic
1090532873 11:127609474-127609496 CTGTCTGGGTAGATGGGTGTGGG + Intergenic
1090886490 11:130881444-130881466 CAGCCTTGCCAGAGGAGAGTTGG - Intronic
1091770796 12:3150018-3150040 AGCTCTGGGCAGAGGGGTGTGGG + Intronic
1092430222 12:8402454-8402476 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1093469564 12:19486143-19486165 TAGTCTGGGCAGATGGGTGGAGG - Intronic
1096470138 12:51870370-51870392 GTGTCTGGGCAGTGGGGAGAAGG - Intergenic
1096495802 12:52038496-52038518 CAGGCTGGGCAGAGGTTGGTAGG + Intronic
1096785790 12:54016609-54016631 CAGCCTGGCCCGTGGGGAGTGGG + Intronic
1096788076 12:54029220-54029242 CAGTCTGAGGAGAAGGGAGGGGG + Intronic
1096871317 12:54594127-54594149 CAGGCTTGGCAGAGGGTACTGGG + Intergenic
1097185869 12:57196024-57196046 CAGTCTGGGGAGGGGGCAGAGGG - Intronic
1098018358 12:66130258-66130280 CAGTCTGGGGAGAGGGTCGGGGG - Intronic
1100107486 12:91193668-91193690 CAGGCTATGCAGAGGGAAGTGGG - Intergenic
1100244908 12:92747883-92747905 GAGGCTGGGAAGAGGGGAGAAGG + Intronic
1101338929 12:103823943-103823965 CTGACTGGGCAGAAGGAAGTTGG - Intronic
1101365228 12:104064530-104064552 CATTGTGGGCAGAGGGGCGGGGG + Exonic
1102494786 12:113312051-113312073 CTCTGTGGGAAGAGGGGAGTTGG + Intronic
1102513242 12:113429480-113429502 CAGGGTGGGCAGAGGAAAGTTGG - Intronic
1102576904 12:113861357-113861379 CAGTGTGGGCAGAAGGAACTGGG - Intronic
1102866899 12:116381884-116381906 GATGCTGGGGAGAGGGGAGTTGG - Intergenic
1103209795 12:119157785-119157807 CAGCCTGGGCAGAGGGGAGGGGG - Exonic
1103273794 12:119695192-119695214 AGATCTGGGGAGAGGGGAGTGGG - Intronic
1103873853 12:124112042-124112064 CAGTTTAGACAGAGGGGAGAAGG - Intronic
1104391897 12:128397851-128397873 GAGGCTGAGCAGAGGGGAGGTGG - Intronic
1104449016 12:128854120-128854142 TAGACAGGGCAGAGGGGAGGTGG - Intronic
1104636186 12:130439011-130439033 CGGTCCGGGCAGAGGGTAGAGGG - Intronic
1105024993 12:132842250-132842272 CAGTCTGTGGAGAGGGAAGGTGG - Intronic
1105247864 13:18668573-18668595 CAGCCCGGGCAGACGGGAGCAGG + Intergenic
1105621863 13:22075696-22075718 GAGGATGGGCAGCGGGGAGTGGG - Intergenic
1105631987 13:22178587-22178609 CTGTCTTGACAGAGGGGAGCTGG + Intergenic
1106301351 13:28469069-28469091 CTGCCTGGGAAGAGGGGAGGAGG - Intronic
1110500552 13:76223092-76223114 CAGGCTGGACAGAGGAGAATAGG + Intergenic
1110696880 13:78501468-78501490 CAGTCTGGGTAGATGGAAGAAGG - Intergenic
1110696893 13:78501546-78501568 CAGTCTGGGTAGATGGAAGAAGG - Intergenic
1110705702 13:78601148-78601170 CATTCGGGGGAGTGGGGAGTGGG - Exonic
1112318635 13:98387601-98387623 GAGACTGGGCAGATGGGAGTTGG + Intronic
1112430504 13:99346568-99346590 CATTCTGGGCAGAGAGGAAAGGG - Intronic
1113056707 13:106275835-106275857 CAGTCAGGGTGGAGCGGAGTTGG + Intergenic
1113137967 13:107114666-107114688 AGGTCAGGGGAGAGGGGAGTGGG + Intergenic
1113547625 13:111166372-111166394 GTGTTTGGGCAGAGGGGAGAAGG + Intronic
1113722450 13:112569919-112569941 AAGAATGGGGAGAGGGGAGTGGG + Intronic
1113863016 13:113502567-113502589 CAGTCGAGGCAGTGGGCAGTGGG + Intronic
1114423032 14:22600515-22600537 CAGTGTGGGCCAAGGGGATTTGG + Intronic
1115308596 14:31957262-31957284 GAGTGGGGGCAGTGGGGAGTGGG - Intergenic
1115447281 14:33505816-33505838 CAGCCTGGGAAGAGGGGAGATGG - Intronic
1117312875 14:54546070-54546092 GAGTATGGGCAGAGAGGAATGGG + Intergenic
1117794793 14:59381461-59381483 TAGTCTGAGGGGAGGGGAGTGGG - Intergenic
1118349817 14:64965742-64965764 CTGTCTGGGGAGCGGGGAGAAGG + Intronic
1118738807 14:68723151-68723173 CGTTCTGGGCTGTGGGGAGTGGG - Intronic
1118883960 14:69851411-69851433 CAGTCTTGGCAGAGAGGAATGGG - Intergenic
1121001833 14:90456652-90456674 CTGTCTGTGCAGTGGGGAGGTGG - Intergenic
1121240596 14:92427337-92427359 CAGTGTGGCCAGAGTAGAGTGGG + Intronic
1121525153 14:94614356-94614378 CAGGCTGGGTGGAGGGCAGTGGG + Exonic
1121676643 14:95758962-95758984 CAGCCAGGGCAGCGGGGACTTGG - Intergenic
1121680850 14:95791662-95791684 CACACTGAGGAGAGGGGAGTGGG - Intergenic
1122048803 14:99041433-99041455 CAGTCTGGCCAGAGTGCAGAGGG - Intergenic
1122088663 14:99323715-99323737 GAGTCTGGGCACAGGACAGTGGG + Intergenic
1122136866 14:99638463-99638485 CAGTCTGGCCAGAGAGGCGCTGG + Intergenic
1122235585 14:100329246-100329268 CAGGCTTGGGAGAGGGGAATGGG - Intronic
1122793460 14:104194091-104194113 AGGGCTGGGCAGAGGGGAGGGGG + Intergenic
1124079427 15:26477651-26477673 AAGTGTGGGCAGAGGGGTGCAGG - Intergenic
1124445203 15:29724256-29724278 CAGGCTGGGCTGGGGAGAGTGGG + Intronic
1125703213 15:41707233-41707255 CAGTCTGGGCATAGCTTAGTTGG + Intronic
1126143526 15:45456267-45456289 CAGTCTGGGCAGCAGGTTGTGGG + Intergenic
1126686601 15:51253604-51253626 CTGACTGGGCAGAGGATAGTAGG - Intronic
1127172907 15:56322194-56322216 CAGTGTGGATAGAGAGGAGTAGG + Intronic
1127801078 15:62477913-62477935 CAGCGGGGGCAGAGGGGAGCGGG + Intronic
1127979560 15:64024688-64024710 TGGACTGGGCAGAGGGGAGAAGG - Intronic
1128126281 15:65195388-65195410 CAGTCAGGGTAGTGGGGTGTGGG - Exonic
1128417471 15:67459745-67459767 CAGTCAGGGCAGTGGAGAGCAGG + Intronic
1129144391 15:73633589-73633611 CTCTCTGGGCAGTGGGGAGCTGG + Intronic
1129256696 15:74337861-74337883 CAGGCTGGGCAGAAAGGAGCAGG + Exonic
1129296819 15:74604335-74604357 CCCTGTGGGCAGAGGGGAGGTGG + Intronic
1129424534 15:75454402-75454424 CAGTCTGGGCCGAGGAGTGCAGG + Intronic
1129674073 15:77622915-77622937 CAGTGTGGGCAGAGGGTGGCCGG - Intronic
1129766655 15:78173806-78173828 CAGTCTGGTCAGAGGTGTCTGGG + Exonic
1129886317 15:79040309-79040331 CAGTCTAGGCAGAGGTGACAGGG - Intronic
1130090883 15:80820245-80820267 CAGACTGGTCAGAGGAAAGTGGG + Intronic
1130306195 15:82713587-82713609 GAGTGAGGGTAGAGGGGAGTAGG - Intergenic
1130336224 15:82959238-82959260 CAGTCTGGGCTGAGGTGTGGAGG + Intronic
1130655536 15:85789780-85789802 CAGGCTGGGCTTAGGGGAGCAGG - Intronic
1130731195 15:86493853-86493875 CAGTCAGGGGAGGGGGAAGTGGG - Intronic
1131472432 15:92708772-92708794 AAGTAAGGGCAGAGGTGAGTGGG - Intronic
1132618727 16:854589-854611 CAGGCTGAGCGGAGGGAAGTAGG + Exonic
1132675278 16:1118813-1118835 CAGGCTGGGCAGAGGGGCCTGGG - Intergenic
1132860844 16:2071056-2071078 CAGGCTGAGCAGAGGTGACTGGG + Intronic
1133923797 16:10178541-10178563 CTGTCTGGGAAGAAGAGAGTAGG - Intronic
1133977397 16:10609168-10609190 CAGTCTGGCCAGCAGGGAGTGGG + Intergenic
1134058072 16:11182593-11182615 CAGGCTGGGCCGAGGGAAGCAGG + Intergenic
1135871881 16:26158760-26158782 CAGTGTGGTCAGAAGGGACTGGG - Intergenic
1136109695 16:28057076-28057098 CTGTGGGGGCAGAGAGGAGTGGG + Intronic
1136156787 16:28388473-28388495 CAGTCATGGCAGAGGGGAATGGG - Intronic
1136206299 16:28726808-28726830 CAGTCATGGCAGAGGGGAATGGG + Intronic
1136297900 16:29314094-29314116 CAGCCTGGACAGAGAGGAGCGGG + Intergenic
1136776104 16:32872713-32872735 CAGGCTTGGCAGACGGGACTTGG + Intergenic
1136894511 16:33988799-33988821 CAGGCTTGGCAGATGGGACTTGG - Intergenic
1137602836 16:49768312-49768334 CATTCTGGGCCGAGAAGAGTTGG - Intronic
1138102886 16:54268657-54268679 CGGACTGGGCAGAGGAGAGCTGG + Intronic
1138713670 16:58997613-58997635 CAGTCAGGGCAGAGGGGACTTGG + Intergenic
1139390951 16:66605835-66605857 CACTCAGGGCAGAGGGCAGAAGG + Intronic
1139468334 16:67165700-67165722 CCGTCTGGGGAGTGGGGCGTGGG - Exonic
1139471174 16:67178975-67178997 CAGTTTGGGCAGGGGGGTGCAGG - Intronic
1139560686 16:67739856-67739878 AAGTGAGGGTAGAGGGGAGTGGG + Intronic
1139950204 16:70664800-70664822 GAATTTGGGCAGAGGGGATTGGG - Intronic
1139965296 16:70741974-70741996 CAGCCTGGGCCGGAGGGAGTAGG - Intronic
1140002836 16:71042813-71042835 CAGCCTGTCCAGATGGGAGTTGG - Intronic
1140299088 16:73738965-73738987 CAGTCTGGTCTGGTGGGAGTTGG - Intergenic
1140496415 16:75393158-75393180 CAGTGAGGGCTGAGGAGAGTGGG - Intronic
1141146331 16:81532841-81532863 CTGTCTGGGCAGAGAGGCGCAGG - Intronic
1141915345 16:87092834-87092856 CTGGCTGGGCAGAAGGGAATGGG - Intronic
1142059544 16:88020599-88020621 CAGCCTGGACAGAGAGGAGTGGG + Intronic
1142192838 16:88725778-88725800 CAGCGTGGGCAGAGAGGAGCAGG - Intronic
1142278921 16:89137701-89137723 AAGGATGGGGAGAGGGGAGTGGG + Intronic
1142413023 16:89925828-89925850 CACTCTGGGCAGAGGGAAGTCGG + Intronic
1142444960 16:90130546-90130568 AAGGCTGGCCAGAGGGGAGGTGG - Intergenic
1203078520 16_KI270728v1_random:1134822-1134844 CAGGCTTGGCAGACGGGACTTGG + Intergenic
1142462550 17:104920-104942 AAGGCTGGCCAGAGGGGAGGTGG + Intergenic
1143141746 17:4745098-4745120 CAGACCGGGCGGAGGGGAGCAGG - Intronic
1143253516 17:5539375-5539397 CCTTCTGGGCAGAGGGAAGAGGG - Intronic
1143480454 17:7224938-7224960 CAGCCTGGGGAGAGGGAAGGAGG - Exonic
1144711314 17:17403462-17403484 AGGTCTGGACAGAGGGGAGGAGG + Intergenic
1144764751 17:17726242-17726264 GAGTCTGGGCAAAGGGTAGAAGG - Intronic
1145347418 17:22049788-22049810 CAGTCTGGGAAGAGTGGATTTGG + Intergenic
1146055061 17:29576820-29576842 GGGTCAGGGCACAGGGGAGTGGG + Intronic
1146801622 17:35828711-35828733 CAGTCTGGGCAATAGTGAGTCGG + Intronic
1148384257 17:47222896-47222918 CAGTCTGGAGAAAGGGGAGCAGG + Intronic
1148578689 17:48728486-48728508 GTGGCTGGTCAGAGGGGAGTGGG + Exonic
1148682227 17:49481043-49481065 CAGAGTGGGCAGAGGGGTGAAGG + Intergenic
1149018532 17:51936516-51936538 CAGTCTTGGCAGAGAAGAGCTGG + Intronic
1149431067 17:56595920-56595942 CAGGCTGGGCCGAGGGGCGGGGG + Intergenic
1149567172 17:57648634-57648656 CACTCTGGGCAGTGGGGTGCTGG + Intronic
1149656208 17:58310808-58310830 CTGTCTGGGGAGAGGGGAGCAGG - Intronic
1150130641 17:62666990-62667012 CAGTCTGGGGAGGGGGGTGGAGG - Intronic
1150291963 17:63987426-63987448 GGGTCGGGGCAGAGGGCAGTGGG - Intergenic
1150630214 17:66875241-66875263 CAGCGTGGGCAGAGGGGAGCAGG - Intronic
1151499086 17:74477543-74477565 CAGGTGGGGCAGAGGGGTGTGGG - Intronic
1151698270 17:75729246-75729268 CAGCCTGGGCAGAGGTGGGAGGG - Exonic
1152086779 17:78224764-78224786 CTGTCTGGGCAGATGGCTGTTGG - Exonic
1152181127 17:78822455-78822477 CAATCTGGGAAGAGGGGTGGGGG + Intronic
1152496654 17:80677573-80677595 CAGTCTGGTGAGAGGGAAGGTGG - Intronic
1153284442 18:3445259-3445281 CATCCCGGGCAGAGGGGACTTGG + Intronic
1154440985 18:14390561-14390583 CAGCCCGGGCAGACGGGAGCAGG - Intergenic
1155046752 18:22109633-22109655 CACCCTGGGGAGATGGGAGTAGG + Intergenic
1156457605 18:37303568-37303590 TAGGCTGGGCAGAGGTGAGGCGG + Intronic
1156514563 18:37669209-37669231 CAGAAAGGGCAGAGGGAAGTGGG - Intergenic
1157680147 18:49598763-49598785 CAACCTGGGGAGAGGGCAGTGGG - Exonic
1159002472 18:62986694-62986716 CACCCTGGGCAGAGTGCAGTGGG + Intergenic
1159868009 18:73728815-73728837 CAGCTTTGGCAGAGGGGAGAGGG + Intergenic
1160397345 18:78582323-78582345 CAGGCTTGGCAGCGGGGAGGTGG + Intergenic
1160546924 18:79664219-79664241 CAGTCATGGCAGAGGGGAAGAGG + Intergenic
1160652257 19:237296-237318 TAGGCTGGCCAGAGGGGAGGTGG + Intergenic
1160662356 19:307037-307059 CAGGCTGAGCAGAGGAGGGTGGG - Intronic
1161012616 19:1967854-1967876 CAGCCTGGGGAGAAGGGAGGAGG - Intronic
1161012637 19:1967915-1967937 CAGCCTGGGGAGAAGGGAGGAGG - Intronic
1161406415 19:4093896-4093918 CAGGCTGGGCTGAGGGCAGGAGG + Intronic
1161813014 19:6481603-6481625 GAGCCGGGGCAGAGGGGAGCTGG - Intronic
1162583839 19:11546983-11547005 CAGGCTGGGCAGGGGGTGGTGGG + Intronic
1162736093 19:12747947-12747969 CAGCCAGGGCAGAGGGTAGAAGG - Intronic
1163528296 19:17834764-17834786 CAGTCTGGGGAGATTGGGGTGGG - Intronic
1163646785 19:18494071-18494093 CACTCTGGGCAGTGGAGAGGAGG - Intronic
1163668190 19:18612832-18612854 CAGCCTGGGAAGCGGGGGGTGGG - Exonic
1164954193 19:32367289-32367311 AAGCCTGGGCAGAGGCGACTGGG - Intronic
1165819410 19:38665159-38665181 AGTTCTGGGCAGTGGGGAGTGGG - Intronic
1166140606 19:40803246-40803268 CAGTTTGGGGAGGGGAGAGTAGG + Intronic
1166395075 19:42433650-42433672 CAGGCTGTGGAGAGGGGAATGGG + Intronic
1167112012 19:47468174-47468196 CAGACTGGGCAAGGGGGAGAGGG - Intronic
1167424976 19:49425565-49425587 CAGTCTGGGCAGAGAAGCATAGG - Intronic
1167632684 19:50635424-50635446 CAGTCTGTGCAGACAGGAATGGG - Intronic
925128091 2:1476094-1476116 CAGCCTGGGCACTGAGGAGTAGG - Intronic
925662785 2:6220601-6220623 GAGCCTGGGCAGATGGGAGAAGG + Intergenic
926221263 2:10937138-10937160 CTTTCTGGGCAGAGGGGGGCAGG - Intergenic
927751802 2:25676172-25676194 GAGTCAGGGCAGAGGGGTGGTGG - Intergenic
927875039 2:26649715-26649737 CAGTCAGGGCAGCTGGGAGAGGG - Intergenic
928196833 2:29222294-29222316 CTTTGGGGGCAGAGGGGAGTTGG + Intronic
929629016 2:43439421-43439443 CATCCTGGGCAGAATGGAGTGGG - Intronic
930701144 2:54457894-54457916 CAGTGCAGGCAGAGGGGAGCCGG + Intronic
931087217 2:58846014-58846036 CAGTCAGGGCAGGGAGGAGAAGG - Intergenic
931496155 2:62809353-62809375 CAGTTGGGGGAGAGGGGAGGAGG - Intronic
931514832 2:63044110-63044132 CAGTCTGGCCAGAGAGCAGTTGG + Intronic
932621059 2:73265193-73265215 AAGTCTGGGGAAAGGGGAGGGGG + Intronic
933131845 2:78681921-78681943 CTGGGTGGGGAGAGGGGAGTGGG - Intergenic
935145308 2:100391337-100391359 AAGTCAGGGGACAGGGGAGTGGG + Intergenic
935356083 2:102201064-102201086 CAGTCTTGGCAGAGGGTCTTGGG + Intronic
935619751 2:105118423-105118445 GAGGCTGGGGAGAGGGGAGTAGG + Intergenic
935788706 2:106571413-106571435 AAGTTTGGGGAGAGGGGAATAGG + Intergenic
937229324 2:120388382-120388404 CAGCCTGGGCAGAGAGCACTGGG + Intergenic
937354956 2:121192481-121192503 GACTTGGGGCAGAGGGGAGTGGG - Intergenic
938502515 2:131837529-131837551 CAGTCTGGGGAGAGTGGATTTGG - Intergenic
939769213 2:146293737-146293759 CAGAGTGGGCAGAGTAGAGTGGG + Intergenic
941295505 2:163734527-163734549 GAGGCTGGGCAAAGGGGAGAGGG - Intronic
942145092 2:173018946-173018968 CAGTATGGGTAGAGGTGGGTTGG + Intronic
942617488 2:177809097-177809119 CAGGCTGAAGAGAGGGGAGTGGG + Intronic
946595634 2:221302957-221302979 CATTCTAGGCAGAGGGGACATGG - Intergenic
947791744 2:232872712-232872734 CTGTCTGGGGAGGGGGGAGATGG - Intronic
947887539 2:233585609-233585631 TAGTCAGGCCAGAGGTGAGTTGG + Intergenic
947889282 2:233602813-233602835 CTTTCTGGGCAGAGGGCATTTGG + Intergenic
947893660 2:233648005-233648027 TAGTCAGGCCAGAGGTGAGTTGG + Intronic
948078393 2:235185130-235185152 CAGTTTTGCCAGAGGGGAGAAGG - Intergenic
948117701 2:235505783-235505805 CAGCCTGGGAAGAGCGGGGTAGG + Intronic
948125704 2:235563425-235563447 CTGCCTGGGCAGAGGAAAGTGGG - Intronic
948426025 2:237886985-237887007 CAGGCTGTGCAGACGGGACTTGG + Intronic
948795249 2:240399238-240399260 CAGTGTGGGCAGAGAGAGGTGGG - Intergenic
1168847714 20:956834-956856 CAGTCTGGGCAGAGCCCAGGGGG - Intergenic
1168924929 20:1571651-1571673 GAGCCTGGGGAGAGGGGAGTGGG + Intronic
1168932598 20:1636119-1636141 CAGCCTGGGGAGAGGGGAGTGGG + Intronic
1169214112 20:3783951-3783973 CATCCTGGGCAGAGGGGCCTGGG - Exonic
1169607409 20:7338116-7338138 CAATCTCTGAAGAGGGGAGTGGG + Intergenic
1170370119 20:15639455-15639477 CAGTGGGGGCTGAGGAGAGTAGG - Intronic
1171330870 20:24337773-24337795 CAGTGAGGTCAGAGGGGAGCAGG + Intergenic
1171519476 20:25764934-25764956 CAGTCTAGGGAGAGTGGATTTGG - Intronic
1171557444 20:26091557-26091579 CAGTCTAGGGAGAGTGGATTTGG + Intergenic
1172095374 20:32457630-32457652 CAGGCCGGGCAGAGGGGGATGGG + Intronic
1172107436 20:32525060-32525082 CAGGCTGGGCAGCGGGAAGTGGG + Intronic
1172315233 20:33948849-33948871 CAGTCTGGGCAGGGTTCAGTGGG - Intergenic
1172390992 20:34565101-34565123 CAGTCTGGACAGGGGCGAGTTGG + Intronic
1172968418 20:38855808-38855830 TAGTCTGGGCTGCAGGGAGTGGG - Intronic
1173188067 20:40856555-40856577 CAGTGTGGGGAGAGGGTGGTTGG - Intergenic
1173709145 20:45139226-45139248 CACACTGGGACGAGGGGAGTTGG - Intergenic
1173791178 20:45828691-45828713 CAGGCTGGGCACTGGGGAGTAGG + Intronic
1175215076 20:57388037-57388059 CAGGCTGGGCAGAGGTGACTTGG - Intergenic
1175697694 20:61114882-61114904 CACTGTGGGCAGTGGGCAGTGGG + Intergenic
1175781581 20:61685659-61685681 CACTCTGTGCAAAGGGGTGTGGG - Intronic
1175794390 20:61762573-61762595 CAGGCTGGACAGAGTGCAGTGGG - Intronic
1176653616 21:9571215-9571237 CAGTCTGGGGAGAGTGGATTTGG - Intergenic
1176992654 21:15517422-15517444 TAGTGGGGGCAGAGTGGAGTGGG + Intergenic
1177385024 21:20397298-20397320 CTTTCAGTGCAGAGGGGAGTTGG + Intergenic
1177754904 21:25334753-25334775 CAGCCTGGGCAGTGGAGACTGGG + Intergenic
1179554275 21:42162614-42162636 ATGGCTGGGCAGAGGTGAGTGGG + Intergenic
1179554392 21:42163128-42163150 ACGGCTGGGCAGAGGTGAGTCGG + Intergenic
1180052215 21:45336333-45336355 CAGCCTGGGCAGAGCGTGGTGGG + Intergenic
1180184316 21:46131912-46131934 CGGGCTGGGCGGAGGGGAGGTGG - Intronic
1181329000 22:22074819-22074841 CAGTCTGGACAGAGAGCAGCAGG + Intergenic
1181530517 22:23514536-23514558 CTGGGTGGGCAGAGGGGAGAGGG - Intergenic
1182129620 22:27841330-27841352 CAGGCTGGGCAGTGGGAACTGGG - Intergenic
1182251871 22:29007151-29007173 TGGTCTGGGCAGAGGTGGGTGGG + Intronic
1182257379 22:29048960-29048982 CAGGCAGAGCAGTGGGGAGTTGG + Intronic
1182279813 22:29211754-29211776 CAATCTGGGCAGAGGACAGTCGG - Intronic
1182551265 22:31102020-31102042 CTGTGTGGGCACTGGGGAGTTGG + Intronic
1182897745 22:33873099-33873121 TGGTTTGGGCAGAGGTGAGTGGG - Intronic
1183073098 22:35409983-35410005 GGGTATGGGAAGAGGGGAGTTGG + Intronic
1183218704 22:36497949-36497971 AAAGCTGGGCCGAGGGGAGTAGG + Intronic
1183315058 22:37132465-37132487 CAGCCTGGACAGAGGAGAGGAGG + Exonic
1183697637 22:39432193-39432215 CACTCTCAGCAGAGTGGAGTTGG - Intronic
1183933502 22:41249118-41249140 TCAGCTGGGCAGAGGGGAGTGGG + Intronic
1184094590 22:42309610-42309632 CAGTGTGGGCAGAGGTGTGGAGG - Intronic
1184147015 22:42617706-42617728 CAGTGTGGCTGGAGGGGAGTGGG - Intergenic
1184289130 22:43489009-43489031 CAGTGTGGGCAGTGAGGGGTGGG + Intronic
1185122645 22:48981736-48981758 CCGTCTGTGCACAGGGCAGTGGG + Intergenic
1185295030 22:50048994-50049016 CAGTGTGGGTGGAGGGGAGCTGG + Intronic
950090167 3:10289509-10289531 GAGCCTGGGCAGAGGAGAGAGGG - Intronic
950140424 3:10611366-10611388 GAGCTTGGGCAGAGGGGTGTGGG + Intronic
950638740 3:14334183-14334205 CACTCTGGGCAGAGGGGGCTGGG - Intergenic
951264901 3:20553199-20553221 CAGGGAGGGCAGAGGGGCGTGGG + Intergenic
951669483 3:25164123-25164145 CAGTCTGGCCACTGGGGAGAAGG + Intergenic
952018158 3:28984487-28984509 CAGTCTGGGAGGAGGGGTCTAGG - Intergenic
954109339 3:48425427-48425449 CAGGCTGGGCGGTGGGGAGGGGG - Intronic
954186125 3:48918503-48918525 CTATCTGGTCAGAGGGGAGCTGG - Exonic
954415989 3:50393635-50393657 CAGGCTGGGCTCAGGGGACTGGG - Intronic
954452745 3:50580452-50580474 CAGCCTGACCAGAGGGGAGGTGG + Exonic
954581155 3:51703571-51703593 CAGTCAGGGTAGAGGGCAGAGGG + Intronic
956436465 3:69238862-69238884 CAGCCTGGGCAGAGAGTGGTAGG - Intronic
956519204 3:70085027-70085049 CAGTGATGGCAGAGGGGAGAGGG + Intergenic
958996617 3:100913001-100913023 CAGTCTAGGCAGAGGCGGGCAGG + Intronic
959557091 3:107733040-107733062 CAGTATGAGCAGAGTGGAGACGG - Intronic
960999500 3:123364386-123364408 ATGTCTGGGCAGTGGGGACTAGG + Intronic
961280237 3:125760754-125760776 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
961314224 3:126023463-126023485 CAGTTAGGGCACAGGGGAGGGGG + Intronic
961372630 3:126440806-126440828 CAGCCTGGGCAGAGGTGGGCTGG - Intronic
961404034 3:126666433-126666455 CAGTCTGGGTAGGGGTGGGTGGG - Intergenic
961442676 3:126962134-126962156 CAGTCTGGTCAGATTGCAGTTGG + Intergenic
961446964 3:126985436-126985458 CTGGCTGTGCAGAGGGCAGTAGG - Intergenic
961874169 3:130008793-130008815 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
962352556 3:134666469-134666491 CAGTCTGGGGAGAGATGAGAGGG - Intronic
962826112 3:139102075-139102097 TAGTCTGGGAAAAGGGGAGTGGG + Intronic
963346888 3:144105563-144105585 CAGGCTGGGGAGGTGGGAGTGGG + Intergenic
963704148 3:148665071-148665093 CTGTCTGGTGAGAGGGGAGAAGG - Intergenic
964717790 3:159741001-159741023 CAGTGTTGGGAAAGGGGAGTTGG - Intronic
966171027 3:177080313-177080335 CAGTCTGGCCAAAGGTGAATAGG - Intronic
966966677 3:185001668-185001690 CAACCTGTGCAGAGGGGAGAGGG - Intronic
967485792 3:190028934-190028956 CAGTCTAGGGAGAGGAGTGTGGG + Intronic
967811239 3:193762746-193762768 CAGTTTGGGCAGAGAGGTGGGGG - Intergenic
968133891 3:196208255-196208277 CAGTCTGGGACGAGGTGAGGTGG - Intronic
968346882 3:198015957-198015979 CAGTTTGGGAAGAGGGAAGATGG + Intronic
968365576 3:198182676-198182698 AAGGCTGGCCAGAGGGGAGGTGG - Intergenic
968648371 4:1750782-1750804 CACTGTGGGCACAGGGGGGTCGG - Intergenic
968651657 4:1762543-1762565 GAGTCAGGGCAGAGGGCAGAAGG + Intergenic
968952536 4:3702392-3702414 CAGTCTGGGCAGTGGGAGGGGGG - Intergenic
968986809 4:3880125-3880147 CAGCCTGGGCAGAGGCCAGAGGG - Intergenic
969066122 4:4482693-4482715 CATTCTGGGCAGAGAGAAGCAGG - Intronic
969246782 4:5939754-5939776 CAGTCTGGGGACAGGGGACAGGG - Intronic
969736512 4:8995029-8995051 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
970515806 4:16829057-16829079 CAGTGAGGGAGGAGGGGAGTGGG - Intronic
971154072 4:24063837-24063859 GAGTCTGGGAAGAGGGGGATGGG - Intergenic
971425359 4:26510110-26510132 CAGTCCAGCCAGAGGGGAGGAGG - Intergenic
974351905 4:60759331-60759353 CAGCTTGGGCACAGGGGAGGTGG + Intergenic
976031411 4:80758566-80758588 AATTCTGGGCAGAAGAGAGTGGG - Intronic
979254610 4:118597843-118597865 AAGGCTGGCCAGAGGGGAGGTGG - Intergenic
979334351 4:119448188-119448210 AAGGCTGGCCAGAGGGGAGGTGG + Intergenic
979367693 4:119845017-119845039 CAGTCTTGGTACCGGGGAGTAGG + Intergenic
980460309 4:133102300-133102322 TAGTCTGGGCAGCAGGGAGTCGG - Intergenic
982353558 4:154443026-154443048 TAGGCTGGACAGAGGGGAGGAGG - Intronic
985272664 4:188208936-188208958 CAGTGTGGGGTGGGGGGAGTGGG - Intergenic
985275556 4:188234206-188234228 AAGTCCGGGCACAGTGGAGTTGG - Intergenic
985587342 5:747632-747654 TAGTCAGGGCAGAGGGGATCGGG - Intronic
985703498 5:1387408-1387430 CAGGCTGGGGTGAGGGGAGGAGG + Intergenic
985789080 5:1915767-1915789 CAGTGGGGGCAGAGTGGGGTGGG + Intergenic
985912994 5:2897573-2897595 GTGGGTGGGCAGAGGGGAGTTGG - Intergenic
985995149 5:3593575-3593597 CAGCCGGGGCACAGAGGAGTGGG + Intergenic
987245163 5:16041525-16041547 CTGTGGGGGCAGAGGGGAGGGGG - Intergenic
987383343 5:17306621-17306643 CAGTCTGGGCAGGAGGCAGCAGG - Intergenic
988231413 5:28484152-28484174 AATTCTGGGCAGAAGAGAGTGGG - Intergenic
988889410 5:35598768-35598790 CAGTGTGGGCAGATGGGGATGGG + Intergenic
990923504 5:60993979-60994001 TAGCCTGGGCAGAAGGGAGCAGG - Intronic
991633564 5:68680771-68680793 CAGGCTGGGAGGAGTGGAGTGGG + Intergenic
992661319 5:78963821-78963843 CACTTTGGGCAGGGGGGAGCTGG + Intronic
993875360 5:93300131-93300153 CAGTATGGGCAAAGTGGATTTGG + Intergenic
995359134 5:111274051-111274073 CAGTGTGAGCAGAAAGGAGTGGG - Intronic
996699395 5:126435168-126435190 CAGTCTGGGGAGAGGGGAATGGG + Intronic
997242043 5:132314854-132314876 CAGTGTCTGCAGAGGGGAGAAGG + Intronic
997249954 5:132380916-132380938 TTGCCTGGGGAGAGGGGAGTGGG + Intronic
997635270 5:135399655-135399677 GAGGCGGGGCAGGGGGGAGTTGG - Intronic
997673460 5:135695180-135695202 CAGTCTCTGAAGAGGGGACTTGG - Intergenic
997933277 5:138089455-138089477 CTGTCTGGGCTGTGGGGAATTGG + Intronic
998971090 5:147593272-147593294 CAGACTGGGAATAGGGCAGTGGG + Intronic
998992610 5:147834653-147834675 CAGTGTGGGGAGAAGGGAATTGG + Intergenic
999258187 5:150221563-150221585 AAGTCAGGGCAGAGAGGAGGAGG - Intronic
999282281 5:150373756-150373778 CAGACTGGGCTGTGGGGAGGGGG - Intronic
999459262 5:151743608-151743630 TAATCTGGGCAGGAGGGAGTGGG + Intronic
1000352276 5:160361283-160361305 CAGTCTGGGCAGAGGGCCCTTGG - Intronic
1001136827 5:169109483-169109505 GAGTCTGGGCACAGTGTAGTTGG - Intronic
1001137874 5:169117423-169117445 CAGGCTGGGAAGAGGTGAGGGGG - Intronic
1001670301 5:173468181-173468203 GTGTCTGGGCAGAGAGGAGAAGG + Intergenic
1002397533 5:178969762-178969784 CAAACTGGGCAGAGTGGAGCTGG - Intergenic
1002447173 5:179296655-179296677 CGGCCTGGGCAGAGGGCAGGAGG + Intronic
1005816133 6:29554152-29554174 CAGGCTGGGCAGTGAGTAGTTGG + Intergenic
1006509681 6:34515190-34515212 CAGGCTGGGGAGCGGGGTGTGGG + Intronic
1006602591 6:35235805-35235827 CTGGCTGGGTAGAGGGGGGTGGG - Intronic
1007724643 6:43907868-43907890 CTGACTGGGCAGTGGGGACTAGG + Intergenic
1008761960 6:54862282-54862304 CAGTCTGGGCTGAGCACAGTGGG + Intronic
1009924580 6:70104334-70104356 CAGTCATGGCAGAAGGGAGAAGG + Intronic
1010098654 6:72077030-72077052 CAGACGAGGCAGAGTGGAGTGGG - Intronic
1010187168 6:73157489-73157511 CAGTCTGGTCACCGGGGAGTTGG - Intronic
1010811141 6:80300078-80300100 CAGTCTGGGCAGTGGGAATATGG - Intronic
1013246796 6:108294799-108294821 CAGTCTGGGCAGTGGGAGGGAGG - Intergenic
1014018841 6:116565393-116565415 CAGTGTGGGCAGCGGGGATGGGG + Intergenic
1015837124 6:137432506-137432528 CAAGCTCAGCAGAGGGGAGTTGG + Intergenic
1016839455 6:148511673-148511695 GAATCTGGGCAGAGGAAAGTAGG + Intronic
1017073706 6:150599749-150599771 CCCTCAGGGCAGAGGGGAGGCGG + Intergenic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018593564 6:165453999-165454021 CATTCTGGGCACACTGGAGTTGG - Intronic
1018654834 6:166025145-166025167 AAGTCTAGGCAGACAGGAGTGGG - Intergenic
1019020547 6:168914164-168914186 AAGTCTGGGCAGATGGAAGCAGG + Intergenic
1019702071 7:2478858-2478880 GAGGCTGGCCAGCGGGGAGTGGG - Intergenic
1019873393 7:3788398-3788420 GAGTCTGTGCAGAGGGGATAAGG + Intronic
1021420903 7:20443661-20443683 CAATCTGGGCAGTGGGGTGAGGG - Intergenic
1021851615 7:24814212-24814234 CAGTGTGGCCAGAGGACAGTGGG + Intronic
1021955935 7:25824358-25824380 GAGCCAGGGCAGAGGGGAGATGG - Intergenic
1023282105 7:38581433-38581455 CAGTGTGGGTAGAGGGGAACTGG + Intronic
1023631194 7:42166079-42166101 CAGGCTGGGCAGTTTGGAGTTGG - Intronic
1024062519 7:45709614-45709636 CATCCTGGGCAGTGGGGAGCTGG - Intronic
1024069705 7:45775509-45775531 GAGGCTGGCCAGAGGGGAGGTGG - Intergenic
1025202368 7:56970217-56970239 CAGGCAGGGCTGAGGGGAGGAGG + Intergenic
1025279961 7:57619874-57619896 CAGTCTGGGGAGAGTGGATTTGG - Intergenic
1025304773 7:57845627-57845649 CAGTCTGGGGAGAGTGGATTTGG + Intergenic
1025610596 7:63072901-63072923 GAATCAGGGCAGAGTGGAGTTGG - Intergenic
1025669580 7:63606710-63606732 CAGGCAGGGCTGAGGGGAGGAGG - Intergenic
1026342372 7:69445530-69445552 GAGTCTGGGCAGATAGAAGTTGG - Intergenic
1026464508 7:70642613-70642635 CAGTATGGACACAGGGAAGTAGG - Intronic
1027001562 7:74657956-74657978 CAGCCTCGGCTGAGGGGAGCTGG - Intronic
1028751861 7:94391863-94391885 TAGTGTGGGGAGAGGGGAGAGGG - Intergenic
1029124673 7:98287878-98287900 GAGGCTGGGCAAAGGGGTGTGGG - Intronic
1029957245 7:104652823-104652845 CAATCTGTGCAGAGGTGACTGGG + Intronic
1031973415 7:128079376-128079398 CTGGCTGGCCAGAGGGGAGGAGG - Intronic
1032087570 7:128891816-128891838 CAGTCTGGGCAGTGGATGGTGGG + Exonic
1032135933 7:129277688-129277710 CTCTTTGGGGAGAGGGGAGTGGG + Intronic
1033380423 7:140811432-140811454 CTCTCAGGGGAGAGGGGAGTAGG + Intronic
1033453459 7:141481882-141481904 CAGCCCGGGCAGGGGTGAGTAGG + Intergenic
1033781864 7:144680361-144680383 CAGCCTGAGCAGAGGAGAGAAGG + Intronic
1034196977 7:149255500-149255522 CTGTCTGGGGGGATGGGAGTGGG + Exonic
1034473483 7:151269224-151269246 CCTGCTGGGCAGAGTGGAGTGGG + Intronic
1035079374 7:156203438-156203460 TAGTCTTAGGAGAGGGGAGTTGG + Intergenic
1035381780 7:158445307-158445329 CAGTCAGGGCAGAGGTGAGCAGG - Intronic
1035523276 8:292190-292212 CAGGGTGGGCAGAGAGGAGAGGG + Intergenic
1036093470 8:5696090-5696112 CAGTCTGTGAAGAGTGGTGTGGG + Intergenic
1036135858 8:6160987-6161009 CAGGCTTGGGAGAGGGGAGCAGG - Intergenic
1036306373 8:7605639-7605661 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1036357219 8:8053624-8053646 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1036694476 8:10965583-10965605 CTGTCTGGAAAGAGGGGAATCGG - Intronic
1036901350 8:12671629-12671651 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1037747763 8:21660621-21660643 CAGTCTGGGAAGAAGAGACTGGG + Intergenic
1037759465 8:21732443-21732465 GAGTCTGCGGAGAGGGGAGGGGG + Intronic
1037954915 8:23048497-23048519 GAGTCTGGGCACGGGGGAATGGG + Intronic
1038229119 8:25684359-25684381 CAGTTTGGGCAGGGTGGGGTGGG + Intergenic
1039158025 8:34584640-34584662 AAGTCTTGGCAGAGTAGAGTCGG + Intergenic
1039476780 8:37842953-37842975 CAGTCCTGGGGGAGGGGAGTGGG + Exonic
1039598092 8:38809068-38809090 CAGGCTGGGCAGAGGGCTGAAGG - Intronic
1040422208 8:47251351-47251373 CAGTTTGGGCCGAGGGGGCTGGG + Intergenic
1041358970 8:57030239-57030261 CAGTTTGTGCAGAGGTGACTGGG - Intergenic
1042526473 8:69769722-69769744 CAGGCTGGGGAGATGGGAGTTGG + Intronic
1046372449 8:113327507-113327529 CCTACTGGGAAGAGGGGAGTGGG - Intronic
1047311216 8:123694030-123694052 CAGTCTGCTCAGAGGTCAGTGGG - Intronic
1047419861 8:124698538-124698560 CAGCCTGGGCAACGGTGAGTTGG - Intronic
1048040250 8:130720626-130720648 CAGTCTGGGCGGTGTGGAGCAGG - Intergenic
1048841928 8:138574255-138574277 CCTTCTGGGAAAAGGGGAGTTGG - Intergenic
1049060497 8:140272724-140272746 CAGTGAGGGGAGAGGGGAGGAGG + Intronic
1049606257 8:143530507-143530529 CAGCCTGGGCACAGGGTGGTGGG + Intronic
1049692728 8:143969707-143969729 CAGGCCGGGGAGTGGGGAGTGGG + Intronic
1049708883 8:144054934-144054956 CAGAGTGGGCACAGGGGAGCAGG + Intronic
1050990848 9:12149700-12149722 AATTCTGGGCAGAAGAGAGTAGG - Intergenic
1051671648 9:19516415-19516437 GAAGCAGGGCAGAGGGGAGTGGG + Intronic
1051895152 9:21978774-21978796 GGGTGGGGGCAGAGGGGAGTAGG + Intronic
1051924518 9:22307547-22307569 CAGCCTGGGCTAAGTGGAGTTGG - Intergenic
1052451259 9:28634444-28634466 AAGTGTGGGGGGAGGGGAGTTGG - Intronic
1052860638 9:33435852-33435874 CAGCCTGGGCTTAGGGGAGATGG - Intergenic
1053274112 9:36770557-36770579 CAGGCTGGGCAGAGGGGGAAGGG + Intergenic
1054809893 9:69426354-69426376 CAGTCTGGGGATGGGGAAGTAGG + Intergenic
1054833269 9:69649416-69649438 GACTCTGGGCAGAAGGGAGAGGG - Intronic
1054945261 9:70788992-70789014 CAGTCTGTGGACAGGGGATTGGG + Intronic
1057182138 9:93035957-93035979 CAGGCTGGGCAGAGGCGGGGTGG - Exonic
1057739171 9:97697062-97697084 CAGTCTGGGGACCGGGGAGGCGG + Intronic
1057861742 9:98646161-98646183 CATTCTTATCAGAGGGGAGTGGG - Intronic
1058531701 9:105912301-105912323 CAGGCTGGGCAGAGGAGTCTAGG - Intergenic
1059368629 9:113807173-113807195 TAGACTGGTCAGAGGGAAGTGGG - Intergenic
1059727391 9:117022817-117022839 CAGAGTGGGCAGTGGGCAGTGGG + Intronic
1060026008 9:120172110-120172132 CACTCTGGGCAGTGTGGAGGGGG - Intergenic
1060402193 9:123355639-123355661 GAGTGTGGGGAGGGGGGAGTGGG + Intergenic
1061222852 9:129262287-129262309 CTCTCTGGGCAGAGGGGTCTGGG + Intergenic
1062070665 9:134553502-134553524 CAGGCTGGGGAGAGGAGAGCAGG + Intergenic
1062116028 9:134809324-134809346 CTGGCTGGGCAGACGGGTGTGGG + Intronic
1062400008 9:136368281-136368303 CAGTCTGGGCAGAAGGGGTTAGG - Intronic
1062451106 9:136616188-136616210 CCGAGTGGGCAGAGGGGAGACGG - Intergenic
1062618562 9:137408962-137408984 CAGCCTGGGAAGGGGGCAGTCGG + Intronic
1062749945 9:138245543-138245565 AAGGCTGGCCAGAGGGGAGGTGG - Intergenic
1203631336 Un_KI270750v1:74662-74684 CAGTCTGGGGAGAGTGGATTTGG - Intergenic
1186442403 X:9597555-9597577 CAGTCTGGCCAGTGGGCAGCTGG - Intronic
1187425117 X:19170661-19170683 CAGGCTGGGCACAGTGGAGCAGG + Intergenic
1187485886 X:19703043-19703065 CAGTGTGGGCATAGTGGAGTTGG - Intronic
1187896053 X:23980568-23980590 GAGCCTGGGGAGAAGGGAGTTGG + Intergenic
1187955436 X:24513181-24513203 CAGACTGGGCAAGTGGGAGTGGG - Intronic
1189889464 X:45584140-45584162 AAGTCTGGGCCTAGGGGACTAGG - Intergenic
1190765721 X:53473872-53473894 CAGTCTTGGCTTATGGGAGTAGG + Intergenic
1192193988 X:69016547-69016569 CAGGCTGGGCCGGGCGGAGTGGG + Intergenic
1192467505 X:71367617-71367639 AAGTCTGGGTTGTGGGGAGTAGG + Intronic
1192510516 X:71718166-71718188 CAGCCTGGGCTGCGGGGAGACGG + Intergenic
1192510713 X:71719105-71719127 CAGCCTGGGCTGCGGGGAGACGG - Intergenic
1192515984 X:71762448-71762470 CAGCCTGGGCTGCGGGGAGACGG + Intergenic
1192516181 X:71763387-71763409 CAGCCTGGGCTGCGGGGAGACGG - Intergenic
1193195123 X:78622560-78622582 CAGTCTGGGTAGAAGGGATGTGG + Intergenic
1193924043 X:87464066-87464088 CATTGTGGGCAGATGGGAGAGGG + Intergenic
1194746746 X:97636601-97636623 GAGTTTGGGGAGAGTGGAGTTGG - Intergenic
1195670021 X:107461859-107461881 GAGTCTGGGCATTGGGAAGTGGG - Intergenic
1195722510 X:107879678-107879700 AATTCTGGGCAGAAGAGAGTGGG - Intronic
1196441173 X:115721448-115721470 CGGTTTGGGCAGAGGTGGGTGGG - Intergenic
1196444701 X:115839436-115839458 CGGTTTGGGCAGAGGTGGGTGGG - Intergenic
1196465844 X:115970541-115970563 CTGTTTGGGCAGAGGTGGGTGGG + Intergenic
1197318000 X:124992213-124992235 CAGTCTTGGCAGTGGGGAGCAGG - Intergenic
1197723790 X:129762243-129762265 GGGTCTGGGCTGAGGGGAGCTGG - Intronic
1198806394 X:140499510-140499532 CAGCCTGGGCTGCGGGGAGCTGG - Intergenic
1199194804 X:145015903-145015925 AAGTCGGGGCGGAGGGGAGCGGG + Intergenic
1200395679 X:155986001-155986023 CAGTTTGGCCAGGAGGGAGTGGG - Intergenic
1200397400 X:155999233-155999255 TACCCAGGGCAGAGGGGAGTAGG - Intronic
1201148614 Y:11081950-11081972 CTGTCTAGGCAGAGGGGCTTTGG + Intergenic