ID: 910432106

View in Genome Browser
Species Human (GRCh38)
Location 1:87168935-87168957
Sequence CAGGGTGTTAAACATTTTTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 208}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910432106 Original CRISPR CAGGGTGTTAAACATTTTTC AGG (reversed) Exonic
904353016 1:29921151-29921173 CAGGGTGTGAGACCTTGTTCAGG + Intergenic
904621529 1:31778244-31778266 CAGGTTCATAAATATTTTTCTGG - Intergenic
905687818 1:39921497-39921519 CAGTTTGTTAAACATTTGCCAGG + Intergenic
906397452 1:45479134-45479156 AAGGATGTTAAAAATTTTTTTGG - Intronic
907944665 1:59124470-59124492 AAGGGAGTTAAACCTTTTTGTGG + Intergenic
909348884 1:74625076-74625098 CAGATTGGTAAACATTATTCTGG + Intronic
909468470 1:76000884-76000906 CAGGGAGTCAAAGATTATTCTGG - Intergenic
909845187 1:80384815-80384837 CAGGGAAATAAACATTCTTCTGG - Intergenic
910349557 1:86279874-86279896 CATGGACTAAAACATTTTTCTGG - Intergenic
910391145 1:86746009-86746031 CATGGTGTTAAAACTTTTTATGG + Intronic
910432106 1:87168935-87168957 CAGGGTGTTAAACATTTTTCAGG - Exonic
912422757 1:109556823-109556845 CAAGTTTTTAAAAATTTTTCTGG - Intronic
914257947 1:145975831-145975853 CAGATTGTTAAAAATTTTGCTGG - Intronic
917580053 1:176367632-176367654 CTGGTTGTTAAACATTTTTCAGG + Intergenic
919396959 1:197062507-197062529 CAGAGTTTCAAGCATTTTTCTGG + Intronic
920779609 1:208975758-208975780 CAGGGAGGTCACCATTTTTCAGG + Intergenic
921787676 1:219251169-219251191 CTGGGTGTTAGACCTTTGTCAGG + Intergenic
922056176 1:222044653-222044675 CATTGTGTTACACATTTATCTGG - Intergenic
923507413 1:234616942-234616964 CTGGATTTTAAACATTTGTCAGG + Intergenic
924218742 1:241851770-241851792 CTGGTTGTTAAACATTTACCAGG + Intronic
924661333 1:246020816-246020838 CATGGTCTTAACCACTTTTCTGG + Intronic
1063082336 10:2780240-2780262 TGAGGTGTTAAACATTTATCAGG + Intergenic
1065673978 10:28154702-28154724 CAGGGCATTAAACATTTCTTTGG + Intronic
1066176602 10:32913724-32913746 CAAGTTGGAAAACATTTTTCAGG + Intronic
1066797903 10:39145003-39145025 CAGAGTATTAAACCTTTCTCTGG + Intergenic
1066803336 10:39215105-39215127 CACAGAGTTAAACATTTCTCTGG - Intergenic
1066810034 10:39318572-39318594 CATGGAGTTAAACTTTTCTCTGG - Intergenic
1068107397 10:52635871-52635893 CAGGGTATGAAATATTTTTATGG - Intergenic
1070016518 10:72538443-72538465 AAGTGTTTTAAATATTTTTCTGG - Intronic
1070616187 10:77971113-77971135 CAGGCTGTTTAAAATGTTTCAGG - Intronic
1071700280 10:87924613-87924635 CAGGATGTTAAATATATTTTAGG - Intronic
1072375565 10:94812457-94812479 CAAGTTGTAAAACATTCTTCAGG - Intronic
1072389433 10:94968103-94968125 CAAGTTGTAAAACATTCTTCAGG - Intronic
1073828773 10:107358056-107358078 CATGGCATTAAACATTTTTCAGG - Intergenic
1074829494 10:117239113-117239135 CATATTGTTAAACATTTTTTAGG + Intergenic
1076030887 10:127156979-127157001 CTAAGTGTGAAACATTTTTCTGG + Intronic
1077793927 11:5471208-5471230 CAGGGAGTTATAAATTTTTGGGG - Intronic
1077972883 11:7213759-7213781 TAGGGTGTTAAACATTTATGAGG + Intergenic
1077986999 11:7362633-7362655 CAAGGTGAAAAACATTATTCAGG - Intronic
1080404824 11:31969743-31969765 CAGAATGCTATACATTTTTCTGG + Intronic
1082296843 11:50450894-50450916 CACAGTGTTAAACATTTCTTTGG + Intergenic
1082298802 11:50478963-50478985 CAGAGAGTTAAACATTTCTTTGG - Intergenic
1082312915 11:50676030-50676052 CAGGGAGTTAAACCTGTTTTTGG - Intergenic
1082584049 11:54912269-54912291 CAGAGAGTTAAACATTTCTTTGG - Intergenic
1082585301 11:54930484-54930506 CACAGAGTTAAACATTTCTCTGG - Intergenic
1082592947 11:55036716-55036738 CACAGAGTTAAACATTTCTCTGG - Intergenic
1082595058 11:55067993-55068015 CACAAAGTTAAACATTTTTCTGG - Intergenic
1082837247 11:57660226-57660248 CAGATTGTTAAACATTTCTGTGG + Intronic
1083242041 11:61395915-61395937 CAGGTTGTTATACACTTTTGTGG + Intronic
1085732023 11:79008054-79008076 CAGGGTGCTAAAAATTTTTATGG + Intronic
1088425870 11:109701718-109701740 CTGGGTGTTAGATATTTTTCAGG - Intergenic
1089331082 11:117689500-117689522 CAGGGTATGAAACGTGTTTCTGG + Intronic
1090165923 11:124546816-124546838 CAGAGTGTTAAATTTTGTTCTGG - Intergenic
1090734900 11:129603630-129603652 CAGGGTCTCAAACATATTGCTGG + Intergenic
1092911603 12:13150036-13150058 CACGGATTTAAAAATTTTTCTGG + Intergenic
1093263524 12:16971008-16971030 CAGCAAGTTAAACATTATTCAGG - Intergenic
1094860765 12:34463679-34463701 CATAGTGTTAAACATTTCTTTGG - Intergenic
1094861753 12:34475606-34475628 CATGGTGTTAAACATTTATTTGG - Intergenic
1094867259 12:34550726-34550748 CACAGTGTTAAACATTTCTTTGG - Intergenic
1095078112 12:37958730-37958752 CAGAGTGTTAAACCTTTGTTTGG + Intergenic
1095829277 12:46566943-46566965 CAGCATGTTGAACATTCTTCAGG - Intergenic
1096599522 12:52719490-52719512 CAGGATTGTAAACATCTTTCTGG - Intergenic
1098403634 12:70100767-70100789 CAGTTTGTAAACCATTTTTCTGG - Intergenic
1098755376 12:74355726-74355748 AAGGGGGTTAAACATTTTTCTGG - Intergenic
1099900242 12:88698715-88698737 CTGGATGTTACACATTTTGCTGG + Intergenic
1100205198 12:92340979-92341001 CACTGTGTTAAGCATTTTTAAGG + Intergenic
1102724528 12:115049070-115049092 CAGAGAGTCAAACATTTTTATGG - Intergenic
1105478806 13:20754610-20754632 CCGGCTTTTAAAAATTTTTCAGG - Intronic
1106002111 13:25733855-25733877 AAGGGTGTTAAACCTATTTGTGG - Intronic
1107569505 13:41642232-41642254 CATGGTCTTAAACATTTTATAGG - Intronic
1111929261 13:94497060-94497082 CATTTGGTTAAACATTTTTCTGG + Intergenic
1115191241 14:30749449-30749471 CATAGTGTTATACATTTTCCTGG - Intergenic
1115722596 14:36179362-36179384 CAATGTGATAAATATTTTTCAGG + Intergenic
1118670216 14:68117712-68117734 CAGGGTGTTAAAGCAATTTCTGG - Intronic
1120116912 14:80629332-80629354 CAGTGTGTTAAACATCTAGCAGG + Intronic
1121598982 14:95188646-95188668 CCGGGTGTTAAACCTTGTGCTGG - Exonic
1123821512 15:24035320-24035342 CAAAGTGTTAAACATTCCTCTGG + Intergenic
1124472272 15:29998722-29998744 GAGTGAGTTAAACATTTATCTGG + Intergenic
1124573322 15:30885152-30885174 CTAGGTGTTTAACATTTTTATGG + Intergenic
1125022704 15:35000756-35000778 CATGGAGCTAAACATGTTTCTGG - Intergenic
1127462148 15:59209055-59209077 CAGGGAGTTAAACAGCTTTTTGG - Intronic
1127516853 15:59703626-59703648 CCAGGTTTTAAACATTTTACTGG - Intergenic
1131180329 15:90234637-90234659 AAGGGTGTTAGTGATTTTTCCGG + Intronic
1131658012 15:94482306-94482328 CAGGGTGTTATTCATTTATCAGG - Exonic
1133526157 16:6607784-6607806 TAGGATGTGAAACATTATTCGGG - Intronic
1134377995 16:13696516-13696538 CAGTGTTTTACACATTTGTCTGG + Intergenic
1137457437 16:48628791-48628813 CAAGGTGTTAAACTTGTTTGGGG + Intergenic
1137972325 16:52998348-52998370 CAGGGGGAAAAGCATTTTTCAGG - Intergenic
1140159576 16:72474139-72474161 CAGACTGATAAACATTTTTGAGG - Intergenic
1141604798 16:85146690-85146712 CACCGGGGTAAACATTTTTCAGG + Intergenic
1142046700 16:87930160-87930182 CAGGGGGTTGGTCATTTTTCTGG + Intronic
1142726525 17:1818992-1819014 CAGAATGTGAAACGTTTTTCTGG - Intronic
1146266914 17:31458791-31458813 CAGGGTGTGAAACACGTTTGGGG + Intronic
1149227673 17:54493898-54493920 GAAGTTGTAAAACATTTTTCAGG + Intergenic
1149813296 17:59698902-59698924 CAGTGCTTCAAACATTTTTCAGG - Exonic
1149917894 17:60628396-60628418 CCGGGTGTTATACATTTTATGGG + Intronic
1150447052 17:65234403-65234425 CTGGGTATTAAACCTTTATCAGG - Intergenic
1153105976 18:1527390-1527412 CAGGCTTTTAAACATTTTTTAGG - Intergenic
1153156375 18:2154078-2154100 CTGGGTGTTACCCATTTTTTGGG + Intergenic
1153994294 18:10426336-10426358 CAGGGGGTGAATCATTTTTTGGG - Intergenic
1156045036 18:32868465-32868487 CAGGGTCTTAAATATTTCTTAGG - Intergenic
1158803917 18:60946857-60946879 CAATGTGTTAAATATGTTTCAGG - Intergenic
1159792157 18:72795280-72795302 CAAGGTGTATACCATTTTTCTGG + Intronic
1160549907 18:79687750-79687772 CAGGGGGTTAAAGTGTTTTCAGG + Intronic
1162496876 19:11028297-11028319 CAGGAGGTTAAACATCCTTCAGG + Intronic
1163289089 19:16367029-16367051 CAGGGTTTTATACTTTTTTATGG + Intronic
1164000615 19:21095040-21095062 CTGGGTATTAAACCTTTGTCAGG + Intronic
1165600828 19:37054763-37054785 CAGGTTGATAAACATTTTCTTGG + Intronic
925618365 2:5765983-5766005 CTTGGTGTGAAACATTTTGCAGG + Intergenic
927027737 2:19087139-19087161 CAGGGTCTGAATCATTTTTTTGG + Intergenic
929400518 2:41575375-41575397 CAGGGTGATAAACATTTTATGGG + Intergenic
930589300 2:53308287-53308309 CAGGGTCAGAAAGATTTTTCAGG - Intergenic
936784459 2:116077120-116077142 CAGTCTGTTACCCATTTTTCTGG - Intergenic
937517462 2:122671419-122671441 CAGGTTCTAAAACAGTTTTCAGG - Intergenic
938225454 2:129612001-129612023 CTATGTGTTAGACATTTTTCTGG + Intergenic
938326457 2:130408362-130408384 CCTGGTTTTAAACAATTTTCTGG - Intergenic
938719770 2:134056140-134056162 CATGGGGTTCTACATTTTTCAGG + Intergenic
939638522 2:144611596-144611618 CAGAGTGTGCAAGATTTTTCAGG + Intergenic
939756989 2:146126446-146126468 TACGGAGTTAAACATTTTTAAGG + Intergenic
940114575 2:150193733-150193755 CAAGGTGGAAAACATTCTTCAGG + Intergenic
941162599 2:162052718-162052740 CAGAGTGTTAAACACAATTCTGG + Intronic
941828586 2:169927801-169927823 CAGGATTTTAAACATTTTGAGGG + Intronic
942850494 2:180478956-180478978 AAGAGTTTCAAACATTTTTCAGG + Intergenic
943105908 2:183545147-183545169 CAAGGTGGAAAACACTTTTCAGG + Intergenic
944392977 2:199238741-199238763 TAGGATTTTAAACTTTTTTCTGG + Intergenic
948099330 2:235360853-235360875 CAGGTAGTTAGACATTATTCTGG + Intergenic
1169344200 20:4817488-4817510 CCAGGTGTTAAACATTTACCAGG + Intronic
1169579925 20:7009815-7009837 CTGTGGGTTAAACATTTTTCAGG + Intergenic
1169712649 20:8582087-8582109 CTGGTTGTTAAACATTTACCAGG + Intronic
1176691650 21:9917663-9917685 CTGGGAGTTACTCATTTTTCTGG + Intergenic
1177133933 21:17290840-17290862 CAGCTTGGAAAACATTTTTCAGG + Intergenic
1181857171 22:25790339-25790361 CATGGTTTTAAACCTTTTTGTGG + Intronic
1181863284 22:25835761-25835783 CAGGGCGTTTCTCATTTTTCTGG + Intronic
949385619 3:3499027-3499049 CATGGTTATAAACATTTTTCTGG + Intergenic
949428005 3:3940454-3940476 CAAGTTGGAAAACATTTTTCAGG - Intronic
949529527 3:4940596-4940618 CAGCGTGTTCAGCATTTTTTGGG - Intergenic
951695164 3:25438744-25438766 TAGGGCATGAAACATTTTTCAGG - Intronic
955444612 3:58996380-58996402 AAAGGTTTTAAATATTTTTCTGG - Intronic
957394886 3:79623755-79623777 CAAGCTGTTAAACATACTTCAGG + Intronic
958688532 3:97430217-97430239 GAGGGTGTCAAAAATGTTTCTGG - Intronic
959335637 3:105061322-105061344 AAGGCTGATAAACATTTTTCAGG + Intergenic
960197035 3:114781386-114781408 AAGCCTGTTAAACATTTTGCAGG + Intronic
960217460 3:115059290-115059312 CAAAGTATTAGACATTTTTCTGG + Intronic
964048340 3:152359420-152359442 CAGGTTGGTAAACATTTACCAGG - Intronic
967469059 3:189841902-189841924 CAGGGGGTAAAACATATCTCAGG + Intronic
967869396 3:194217602-194217624 CACTGTGTTAAATATTTTGCAGG + Intergenic
971171816 4:24241504-24241526 AAGGGATTGAAACATTTTTCTGG - Intergenic
971566950 4:28156718-28156740 CTGGGTGTTAGACCTTTGTCAGG - Intergenic
971906219 4:32729368-32729390 CAGGGTGTTATTCTTTTTTATGG + Intergenic
972617893 4:40717804-40717826 TAGGGTTTTAAACCTATTTCAGG - Intergenic
973842776 4:54879287-54879309 CAGGCTGTTAAACATTTCCCAGG - Intergenic
977295780 4:95207181-95207203 CAGGGTTTTAAATACTTTTGTGG + Intronic
978115301 4:105012899-105012921 AAGTGTGTTAATCATTTTTTAGG - Intergenic
979098949 4:116590370-116590392 CAGGCTGTAGAACAATTTTCTGG + Intergenic
979543987 4:121918918-121918940 CAGGAGGTAAAACACTTTTCAGG - Intronic
980364226 4:131777866-131777888 CTGGGAGTTACTCATTTTTCTGG + Intergenic
982492483 4:156046372-156046394 GAGGGTGTTAAACATTTCGGTGG + Intergenic
982788961 4:159568209-159568231 CAGGATGTTAGACCTTTGTCAGG + Intergenic
984348045 4:178556944-178556966 CAGGCAGTTGAACATTCTTCAGG + Intergenic
986647160 5:9928737-9928759 CAGGATCCTAAAAATTTTTCTGG + Intergenic
988019772 5:25608058-25608080 GAGGAAGTTGAACATTTTTCTGG - Intergenic
989521515 5:42407335-42407357 CAGGGTCTTCAAAATTTTCCTGG - Intergenic
989835467 5:45983300-45983322 CACGGAGTTAAACATTTCTATGG + Intergenic
989848366 5:46175134-46175156 CAGAGAGTTAAACATTTCTCTGG - Intergenic
989850736 5:46206758-46206780 CACAGTGTTAAAAGTTTTTCTGG + Intergenic
989853308 5:46243561-46243583 CATAGAGTTAAACATTTCTCTGG - Intergenic
990517072 5:56540234-56540256 CAGGGTAATAAACATTTTTCAGG + Intronic
993167660 5:84378271-84378293 CAAGATGTTCAACATTTTTTGGG - Intronic
993333169 5:86624451-86624473 CAGGGTGTTAGAGATTTATGTGG - Intergenic
993839178 5:92855187-92855209 CAGGGAGTTAAACATTCTGATGG + Intergenic
996043295 5:118841800-118841822 CAGTGTTTTAAACATATTTTGGG + Intronic
996111562 5:119571907-119571929 GAGGGTGCAAAACTTTTTTCAGG + Intronic
996369975 5:122742846-122742868 CTGTGTGTTAGACATTTTTCTGG - Intergenic
1000044308 5:157509108-157509130 CAGGCTTTTAAACATTTTCTGGG + Intronic
1000699651 5:164433053-164433075 CTGGTTGTGAAACATTTTTCTGG - Intergenic
1009563132 6:65274593-65274615 CAGGGTTATAAAAATTCTTCAGG + Intronic
1009716640 6:67406004-67406026 CAGGCTGTTGAGCTTTTTTCAGG - Intergenic
1010624281 6:78117815-78117837 CAGGGTTTTATTCATTTTTAAGG - Intergenic
1011802893 6:91037672-91037694 CATGGTGTTGACCATTTTTTTGG + Intergenic
1014075406 6:117229425-117229447 GAGGGTGTCAAACATTTTTAAGG + Intergenic
1015874379 6:137808243-137808265 CATGTTGTTAAACATGCTTCAGG - Intergenic
1019013794 6:168864791-168864813 CTGGGTGTTATTCATTTGTCAGG + Intergenic
1023551220 7:41371839-41371861 TCAGCTGTTAAACATTTTTCTGG + Intergenic
1023576338 7:41631726-41631748 CAGGCTGAAAAACATTCTTCTGG - Intergenic
1024042649 7:45567267-45567289 CGGGGTGTTAAAGTTTTTGCTGG + Intergenic
1024844209 7:53622636-53622658 CAGATTGTTAGACATTCTTCTGG + Intergenic
1025535435 7:61942093-61942115 CAGAGAGTTAAACATTTCTTTGG + Intergenic
1025583709 7:62753797-62753819 CACAGAGTTAAACATTTTTTTGG + Intergenic
1025584829 7:62770340-62770362 CAGAGAGTTAAACATTTATTTGG - Intergenic
1025588104 7:62818778-62818800 CAGAGTGTTAAACCTTTCTTTGG - Intergenic
1025597892 7:62954136-62954158 CAGAGAGTTAAACATTTCTTTGG + Intergenic
1025599141 7:62972751-62972773 CAGAGAGTTAAACCTTTTTTTGG + Intergenic
1027566301 7:79799392-79799414 CAGGGAGTCAAATATTATTCTGG - Intergenic
1027738347 7:81964811-81964833 CAGGTTGTTAACCTTTTTTGCGG - Intronic
1028675700 7:93458207-93458229 CAGAGTGTTAATAATTTTTGTGG - Intronic
1028761283 7:94499348-94499370 AAGGGTGTTAATCATTGATCAGG - Intergenic
1030164238 7:106537148-106537170 AAAGGTGTTTAACATTTTTAAGG + Intergenic
1030627307 7:111858375-111858397 GAGTTGGTTAAACATTTTTCTGG + Intronic
1033677011 7:143552706-143552728 CAGCATGTGGAACATTTTTCAGG - Intergenic
1033694824 7:143776731-143776753 CAGCATGTGGAACATTTTTCAGG + Intergenic
1035913409 8:3593951-3593973 CAAGGTGCTAAAAAGTTTTCTGG + Intronic
1036600915 8:10259594-10259616 CTAGGTGCAAAACATTTTTCTGG + Intronic
1039139760 8:34373429-34373451 CAGGTTGTCACACAGTTTTCAGG + Intergenic
1040129389 8:43776867-43776889 CAGAGAATTAAACATTTTTTTGG + Intergenic
1040767225 8:50927662-50927684 CAAGGAGTTAAACTTTTTTGAGG - Intergenic
1042219057 8:66455566-66455588 CAGGGGCATAAATATTTTTCAGG - Intronic
1042716724 8:71781247-71781269 CAGGGAGATAAAGATTTTTAAGG + Intergenic
1043093283 8:75931415-75931437 CTGGATGTTAAACCTTTGTCAGG - Intergenic
1043788281 8:84430214-84430236 CATAGTGATAAAAATTTTTCAGG + Intronic
1043879863 8:85529934-85529956 AAGGGTTCTGAACATTTTTCTGG + Intergenic
1049346002 8:142139002-142139024 CAGGGTGTTAAACTTTTTCAGGG - Intergenic
1050891897 9:10835209-10835231 CAGGGTCTGAAACATGGTTCAGG - Intergenic
1051853476 9:21536086-21536108 GAGGCTCTAAAACATTTTTCTGG + Intergenic
1052482657 9:29051183-29051205 CATGGTGTTATACATTCTACGGG + Intergenic
1053628582 9:39903759-39903781 CTGGGAGTTACTCATTTTTCTGG + Intergenic
1053777483 9:41562585-41562607 CTGGGAGTTACTCATTTTTCTGG - Intergenic
1054215305 9:62346943-62346965 CTGGGAGTTACTCATTTTTCTGG - Intergenic
1054672176 9:67808406-67808428 CTGGGAGTTACTCATTTTTCTGG + Intergenic
1054958216 9:70938033-70938055 CAGTTTGCTAACCATTTTTCAGG + Intronic
1055214081 9:73836818-73836840 CAGGGTGTTTAACAGTTTCAAGG - Intergenic
1057330157 9:94106765-94106787 CAGGGAGTTACACATTACTCTGG + Intronic
1058212755 9:102191485-102191507 CATGCTATTAAACATTTTTGTGG - Intergenic
1059848502 9:118309053-118309075 GAAGGTGTTAAATATTTATCAGG + Intergenic
1203787197 EBV:134586-134608 GAGGGTGTCAAACTTTTGTCCGG - Intergenic
1191264387 X:58369816-58369838 CAGAGAGTTAAACATTTCTTTGG - Intergenic
1195597712 X:106711615-106711637 CAGCATGTTGAACATTTTTATGG + Intronic
1196634082 X:117979613-117979635 CAGTGTTTTAAAAATCTTTCAGG - Intronic
1197540652 X:127756166-127756188 TATGTTGTTAAACATTATTCTGG + Intergenic
1198502780 X:137268737-137268759 CAGTTTGTTATACATGTTTCCGG - Intergenic