ID: 910432203

View in Genome Browser
Species Human (GRCh38)
Location 1:87169909-87169931
Sequence TCTGGGCCCCAGGAATTACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 210}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910432195_910432203 29 Left 910432195 1:87169857-87169879 CCTGGGACCACCTGCATCAGAAT 0: 2
1: 5
2: 31
3: 145
4: 649
Right 910432203 1:87169909-87169931 TCTGGGCCCCAGGAATTACTGGG 0: 1
1: 0
2: 1
3: 11
4: 210
910432197_910432203 19 Left 910432197 1:87169867-87169889 CCTGCATCAGAATTGCTTGCTGA 0: 1
1: 0
2: 0
3: 12
4: 150
Right 910432203 1:87169909-87169931 TCTGGGCCCCAGGAATTACTGGG 0: 1
1: 0
2: 1
3: 11
4: 210
910432196_910432203 22 Left 910432196 1:87169864-87169886 CCACCTGCATCAGAATTGCTTGC 0: 1
1: 0
2: 6
3: 41
4: 243
Right 910432203 1:87169909-87169931 TCTGGGCCCCAGGAATTACTGGG 0: 1
1: 0
2: 1
3: 11
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910432203 Original CRISPR TCTGGGCCCCAGGAATTACT GGG Intergenic
900399210 1:2466181-2466203 TCTGGGCCCCAGGTCTCAGTGGG - Intronic
900595764 1:3479505-3479527 TCTGGTCCCCAGGAGTGACCGGG + Exonic
901978853 1:13018129-13018151 TCTCGGCCCCATAAATTAATTGG + Intronic
902003228 1:13210809-13210831 TCTCGGCCCCATAAATTAATTGG - Intergenic
902022453 1:13356559-13356581 TCTCGGCCCCATAAATTAATTGG - Intergenic
902289342 1:15426513-15426535 ACTGGACCCCAGGAAGTACAGGG + Intronic
902589787 1:17465583-17465605 TCTGGGCCCCAGGAAGTTTAGGG + Intergenic
902613002 1:17608084-17608106 TCTGGGTCCCAGGGATTCCCGGG + Intronic
903019474 1:20383964-20383986 TCTGGGGCCCAGGAAGGATTTGG - Intergenic
904683195 1:32242796-32242818 GCTGGGGCCCAGGGATGACTGGG + Intergenic
905518687 1:38580928-38580950 TCTGGGCCCCCAGAATTTCAAGG + Intergenic
905625275 1:39485996-39486018 TCTGGGCCCCATCCATTACAGGG - Exonic
908633220 1:66133667-66133689 CCTGGGCCCCAAGGATTACAAGG - Intronic
908894716 1:68885249-68885271 TCTGGGAGCCAGGACTTAATGGG + Intergenic
909625494 1:77711275-77711297 TCTTGGCCCCACAAAGTACTGGG - Intronic
909882753 1:80900788-80900810 TCTGAGCCTCTGGAATTGCTGGG + Intergenic
910432203 1:87169909-87169931 TCTGGGCCCCAGGAATTACTGGG + Intergenic
911908198 1:103595808-103595830 ACTGGGCCCCTGAAATCACTAGG - Intergenic
911910559 1:103628846-103628868 ACTGGGCCCCTGAAATCACTGGG - Intergenic
911914720 1:103683658-103683680 ACTGGGCCCCTGAAATCACTAGG + Intronic
911917975 1:103722971-103722993 ACTGGGCCCCTGAAATCACTGGG - Intronic
912411764 1:109484755-109484777 TCTGGGCCCCAGGGAGCACCTGG + Intronic
912841363 1:113042329-113042351 CTTGGGCCCCGGGAATTCCTGGG + Intergenic
913292033 1:117282816-117282838 ACTGGGCCCCAGTAATCAGTGGG + Intergenic
915784641 1:158596797-158596819 TCTGGGCCCCAGGAAAGCATGGG - Intergenic
920840197 1:209547510-209547532 TCTGGGGCCTAGGTATTTCTTGG - Intergenic
921579770 1:216882447-216882469 TCTAGGTGCTAGGAATTACTTGG - Intronic
921808887 1:219489110-219489132 CCTGGGCCCCTGAAAGTACTGGG - Intergenic
922048427 1:221968255-221968277 CCTGGGCTCCAGGCATTCCTTGG - Intergenic
922462306 1:225823279-225823301 CCTTGGCCCCACGAAGTACTGGG + Intronic
922918867 1:229283645-229283667 TCAGGGCCCAAGGAATGATTTGG - Intronic
1064221075 10:13440506-13440528 TCTGGGCCCCTGGTTTTACAGGG - Intronic
1065168688 10:23006605-23006627 TCTTGGCCCCTGGAAGTATTTGG - Intronic
1065871259 10:29958156-29958178 ACTGAGCCCGAGGAATTAGTTGG - Intergenic
1067156574 10:43786028-43786050 TCTTGGCCCCTGGAAATGCTGGG + Intergenic
1067205702 10:44210258-44210280 TCTGGGCCCCACAAATTATGTGG + Intergenic
1068787703 10:60994819-60994841 TCTGGGCCCTAGAATTTACTTGG - Intronic
1069942658 10:71965625-71965647 GCTGGGCCCCAGGATGTACGGGG + Intronic
1070307403 10:75247903-75247925 CCTGGGCCCCAGGTGTTCCTGGG - Intergenic
1072881104 10:99230751-99230773 TAAGAGCCCCAGGAATTGCTGGG - Intronic
1073403700 10:103278348-103278370 ACTGGGCCCCAGGACTTAAGGGG + Intronic
1073568498 10:104556155-104556177 TCTAGGCCTCAGGAAATACAAGG - Intergenic
1076372195 10:129963176-129963198 TCTGCGCCCTCGGACTTACTCGG - Intronic
1076585613 10:131545445-131545467 TGTGGGCCCCAGGTATTCCGGGG - Intergenic
1077585932 11:3453196-3453218 TCTCGGCCCCATAAATTAATTGG + Intergenic
1077725059 11:4666259-4666281 CCTGGGCCCCAGGGATCCCTGGG - Intergenic
1078128642 11:8593879-8593901 GCTGGGCCCCAGGAGACACTCGG + Intronic
1078135679 11:8649752-8649774 TCTGGGCCCGAGGAAAGAATGGG + Exonic
1080155263 11:29103358-29103380 TCTGGGCCCCTGAAAGTGCTGGG + Intergenic
1081575744 11:44317688-44317710 TCTGGGGGCCAGGAACTCCTTGG - Intergenic
1083178234 11:60966603-60966625 TCTGGGCCTCAGGAAACACAAGG + Intergenic
1084676358 11:70637705-70637727 TCTGGGCCCCAGGGCTTTCGAGG - Intronic
1085203369 11:74715226-74715248 TCTGAGCACTAGGAATTAGTGGG + Intronic
1086074989 11:82841138-82841160 TCTGGGCAGCAGGAATAACAGGG + Intronic
1088890603 11:114041223-114041245 TCTGGCCACCAGGAATGAGTTGG + Intergenic
1090815797 11:130294156-130294178 TCTCGGCCCCACAAAGTACTGGG - Intronic
1091324540 11:134676556-134676578 TCTGGGCCCCTGGGAAGACTCGG + Intergenic
1093043761 12:14417382-14417404 TCTGGACCCAAAGGATTACTAGG - Intronic
1095599381 12:43997878-43997900 TCTGGGCACCAACACTTACTAGG - Intronic
1095879045 12:47112783-47112805 CCTGGGCTCCAGGGAGTACTGGG + Intronic
1096839989 12:54374287-54374309 TCTGAGCCCCAGGAATAACCAGG - Intronic
1098384378 12:69903477-69903499 TCCTGGGCCCCGGAATTACTTGG + Intronic
1098838886 12:75455099-75455121 CTTTAGCCCCAGGAATTACTTGG + Intergenic
1098856897 12:75663252-75663274 TCTGGGCTCCATGATCTACTAGG + Intergenic
1099292088 12:80786489-80786511 TCTGGGCTGCAGGCATTCCTTGG + Intergenic
1101742529 12:107511866-107511888 TCTGGCCCCCAGGTTTTAGTGGG + Intronic
1102346149 12:112162627-112162649 GCTGGGCCCCAGGATTGGCTTGG - Intronic
1103617895 12:122166618-122166640 TCTGGGCCCCATGACTGAGTAGG + Intergenic
1104468209 12:129007071-129007093 CCTGGACCCCAGTAATAACTTGG - Intergenic
1107043510 13:35973021-35973043 TGTGGGCCCCAGAATGTACTGGG - Intronic
1108420691 13:50246204-50246226 TCTGAGCCCCACAAATGACTGGG + Intronic
1112376953 13:98851539-98851561 TCTGGGCCCCAGGTACTGGTTGG + Intronic
1113705051 13:112424838-112424860 TCTGGGCTGCAGGTATTTCTCGG + Intronic
1114665644 14:24375902-24375924 TCTGGGCCCCTGGAAAGGCTGGG + Intronic
1118724900 14:68622041-68622063 CCTGGGCACCTGGAATGACTGGG + Intronic
1121404429 14:93710680-93710702 GCTGGGCCCCTGGCATTAATTGG + Intergenic
1121829756 14:97039956-97039978 TCTGGGACCCATGAATGTCTGGG + Intergenic
1121911564 14:97796765-97796787 TCTGGGCCCCTGGGGCTACTGGG - Intergenic
1122857147 14:104565430-104565452 TCTGGGCCCCAGGGCTTCCAAGG + Intronic
1202897271 14_GL000194v1_random:17410-17432 TCTGGGCCCCAGGTATACCCTGG + Intergenic
1125535479 15:40439568-40439590 GCTGGGCCCCAGGAACGCCTTGG - Intergenic
1128567503 15:68711054-68711076 TGTGGACCCCAGGAATGACAGGG - Intronic
1129077012 15:73005566-73005588 TGTGGGCCACAGGAAGGACTTGG + Intergenic
1130033492 15:80336937-80336959 TCTGGTCCCCAGGCATAATTTGG + Intergenic
1131181324 15:90241835-90241857 TCCGGGCCCACAGAATTACTCGG - Exonic
1132338075 15:101061431-101061453 TCGGGGCTCCTGGCATTACTTGG - Intronic
1132924158 16:2419000-2419022 CCTGGGCCCCCCAAATTACTGGG - Intergenic
1138528305 16:57621212-57621234 TCTGTGCCCCAGGACTTAGGGGG + Intronic
1140566605 16:76049569-76049591 TCTGGCCCCCAGCAACTCCTGGG - Intergenic
1141404052 16:83775913-83775935 TCTGGGGCCCAGGAAATATAGGG - Intronic
1141521596 16:84583753-84583775 TCTGAGCCCCAGGACTAACCAGG - Intronic
1142088506 16:88197625-88197647 TCTGGGCCCCAGGAACCATGGGG - Intergenic
1143168250 17:4910014-4910036 GCTGGGCCTCAGGTATTCCTGGG - Intergenic
1143403914 17:6664085-6664107 TCAAGGCCTCAGGAATTCCTGGG + Intergenic
1143734838 17:8904380-8904402 TCTGTGCCCCAGGAACAAGTAGG - Intronic
1144017641 17:11211670-11211692 TCTGGACTCCAGGCATTACAAGG - Intergenic
1144524947 17:15981417-15981439 AGTGGGCCCCATGAATCACTAGG - Intronic
1146809903 17:35894851-35894873 TGTGGGCAGCAGGAACTACTTGG + Intergenic
1151398716 17:73841996-73842018 TCAAGGCCCCAGAAATTCCTTGG - Intergenic
1152292557 17:79448525-79448547 TCTCGGCCCCAGGTGTTCCTTGG - Intronic
1152623894 17:81379672-81379694 TCTGGGACCCGGGCATTGCTGGG - Intergenic
1152714703 17:81893106-81893128 GCTGAGCCACAGGAATCACTTGG - Intronic
1154354811 18:13616685-13616707 TCTGGGACCCAGGTATCCCTGGG + Intronic
1156024129 18:32631909-32631931 TTTGGACCCCAGGAATTACACGG - Intergenic
1156496495 18:37529221-37529243 TCTGGTCCTCAGGAAGTGCTTGG + Intronic
1157434206 18:47654734-47654756 TCAGGCTCCCAGGAATTCCTAGG - Intergenic
1160586629 18:79916883-79916905 TCTGGGCCTCTGGAACTTCTGGG - Intronic
1161812241 19:6477388-6477410 TCTGGGCCCCAGGCCTCAGTGGG - Exonic
1164531150 19:29049131-29049153 TGGGGGCCCCAGGCATTCCTTGG + Intergenic
1165958200 19:39515203-39515225 CCTGGGCCCCATGAATAACCAGG + Exonic
1166956447 19:46468645-46468667 TCAGGGACCCAGAAATTTCTTGG - Intronic
1167248880 19:48390514-48390536 TCTGGACCACAGGAATTTCAGGG - Exonic
1167958526 19:53087451-53087473 GCTGAGCCCCAGGAAGTACAGGG + Intronic
926543797 2:14213045-14213067 TCTGGACCACAGGAAATGCTAGG - Intergenic
927337885 2:21946480-21946502 TCACGGCCCACGGAATTACTGGG - Intergenic
927677160 2:25114584-25114606 TCTGGGGCCCAGGACTGCCTAGG - Intronic
928878789 2:36073124-36073146 TTTGGGCCTCAGGAACAACTAGG + Intergenic
932158412 2:69438701-69438723 TGTGGGCCATAGAAATTACTAGG - Intergenic
932295007 2:70616828-70616850 TCTGGGCCACAGGACTTGGTGGG - Intronic
933163743 2:79053689-79053711 TCTGGGCTGCAGGCATTCCTTGG - Intergenic
933661492 2:84931113-84931135 CCTGGGCCTCCGGAAGTACTGGG - Intergenic
933706823 2:85297573-85297595 TCTGGGCCCCACAAAATGCTGGG - Intronic
936012112 2:108931391-108931413 TCTGGGCTCCAGGACTTAGGAGG + Intronic
936518223 2:113195933-113195955 TCTGGCCCTCCGGTATTACTTGG - Intronic
936518328 2:113196522-113196544 TCTGGGGCCCAGGAATAACTAGG - Intronic
939367800 2:141257375-141257397 GCTGGGCTCCAGGGATTACATGG - Intronic
941141872 2:161793530-161793552 TGTGGGCACTAGGAATGACTAGG - Intronic
941388051 2:164877513-164877535 TCTTGTCCCCAGCAATCACTGGG - Intergenic
946196557 2:218035696-218035718 TCTGGGCCCCAGGATCCATTGGG + Intronic
947313564 2:228830276-228830298 TTTGGGAATCAGGAATTACTGGG - Intergenic
948537112 2:238654599-238654621 TCTTGGCCCCAGGAACCACGTGG + Intergenic
948793772 2:240391975-240391997 GCTGGGTCCCAGGAAATTCTAGG - Intergenic
1168907503 20:1417927-1417949 TCTGGGCCCCAGGGACCAATTGG - Intergenic
1169202439 20:3718575-3718597 CTGGGGCCCCAGGATTTACTCGG - Intergenic
1172836973 20:37879285-37879307 CCTGGGCCCCAGGAAGGCCTGGG - Intergenic
1172875044 20:38158919-38158941 TCCGGGCCCCGGGAATTTCTTGG + Intronic
1175364477 20:58442833-58442855 TGTGGTCCCCAGGACCTACTAGG + Intronic
1176616955 21:9033399-9033421 TCTGGGCCCCAGGTATACCCTGG + Intergenic
1178430746 21:32516757-32516779 TCTAAGCCCCTGGGATTACTAGG - Intergenic
1181546268 22:23604248-23604270 CCTTGGCCCCAGGACTCACTTGG + Intergenic
1181845669 22:25706919-25706941 GCTGGGGCCAAAGAATTACTTGG - Intronic
1182115408 22:27753545-27753567 GCTGGGCCCCAGGAAGTAGTGGG - Intronic
1183483443 22:38077161-38077183 TCTAGGCCCCAGGAAGGTCTGGG - Intergenic
1184429334 22:44432046-44432068 TCTGGGCCCCAGGGGTTGCGTGG + Intergenic
1184758770 22:46533280-46533302 TCTGGGTCACAGGATTTGCTTGG - Intronic
951622123 3:24614296-24614318 TCAGGGACCCAGGATTGACTTGG + Intergenic
953796022 3:45986614-45986636 TCTGGGACTCATGAATTCCTGGG - Intronic
955952297 3:64254636-64254658 TCTGGGCTCAAAGAATGACTAGG - Intronic
957069401 3:75554120-75554142 TCTCGGCCCCATAAATTAATTGG - Intergenic
957848143 3:85766345-85766367 TCAGGGCCCCAGAACATACTAGG + Intronic
962342434 3:134596773-134596795 TCTGGGATTCAGGAAGTACTTGG - Intergenic
963029409 3:140952743-140952765 TCTTGGAACCAGGAATGACTGGG + Intronic
963603787 3:147397540-147397562 TCAGGGCTCCTGGAAGTACTCGG + Intronic
965543496 3:169892810-169892832 TCTGTGCCACTGGAATTTCTAGG - Intergenic
965631952 3:170742110-170742132 TGTAGGCCCCAGCAATTTCTTGG - Intronic
966249110 3:177842290-177842312 TCTGGGCCTCAGGAAAGATTTGG + Intergenic
968982612 4:3858587-3858609 TCTGGGCCCGAGGCATTCCTGGG + Intergenic
969812798 4:9661723-9661745 TCTTGGCCCCATAAATTAATTGG - Intergenic
969836683 4:9848118-9848140 GGTGGGCACCAGGAATTCCTAGG - Intronic
970445558 4:16120838-16120860 TCTGGACCCCAGGAGTTCCCAGG - Intergenic
976815872 4:89148327-89148349 CCTGGGCCCCATGGATGACTGGG - Intergenic
977022494 4:91774780-91774802 TCTGGGCCCCATCAATCACTAGG + Intergenic
980491342 4:133532570-133532592 CCTGGGCTCCAGGCATTCCTTGG + Intergenic
983452344 4:167925192-167925214 CCTGGGCTGCAGGCATTACTTGG - Intergenic
987056868 5:14201803-14201825 TCTGGGCCCCAAGAAATAGGTGG + Intronic
989817819 5:45757604-45757626 TCTCAGCTCCAGGAATGACTTGG - Intergenic
993379750 5:87192768-87192790 ACTGGCCACCAGGAATCACTTGG - Intergenic
994132845 5:96250329-96250351 TCAGGGCCCCAGGACCTTCTAGG + Intergenic
997468866 5:134105530-134105552 TCTTGGCCCTAAGAATGACTGGG - Intergenic
997543858 5:134688928-134688950 TCTTGGCCCCACAAAGTACTGGG + Intronic
998850856 5:146349399-146349421 CCTGGGACCCAGGAATTTATGGG - Intergenic
999752623 5:154640821-154640843 TCTCGGCCCCATAAATTAATTGG + Intergenic
1000150052 5:158491316-158491338 TCTGGGACCCAGGTTTTGCTTGG - Intergenic
1002485082 5:179529811-179529833 ACTGGGTTCCAGGAATTACGTGG + Intergenic
1004925684 6:20413057-20413079 TCTGGGCCCCATTAATAAGTGGG + Intronic
1007571988 6:42899456-42899478 TCTCGGCCCCATAAATTAATTGG + Intergenic
1007615591 6:43178210-43178232 TCTGGGGGCCTGGAATTCCTAGG + Intronic
1012442077 6:99270232-99270254 TCTGAGCCCCAGGAATCAGCAGG + Intergenic
1013226309 6:108121370-108121392 TCTGGGCCCCAGGATTTGTGAGG - Intronic
1015111466 6:129596615-129596637 ACTGTGTGCCAGGAATTACTGGG - Intronic
1016613128 6:146016077-146016099 TCTGTGGCCCAGGGATTACAAGG - Intergenic
1019168473 6:170115168-170115190 TCTGGTCCCAAGGCATTACCTGG - Intergenic
1019904985 7:4055878-4055900 TCTGTGACCCATGAATTAATTGG + Intronic
1023698876 7:42874020-42874042 CCTGGGCCGCAGGCATTCCTTGG + Intergenic
1023852293 7:44157246-44157268 TCTGGGCACCAGGAACAGCTTGG - Intronic
1026930123 7:74219324-74219346 TCAGGGACCCAGCAATGACTTGG - Intronic
1027260705 7:76462354-76462376 CCAGGGCCCCAGGAACTCCTGGG - Intronic
1027312084 7:76960467-76960489 CCAGGGCCCCAGGAACTCCTGGG - Intergenic
1028010079 7:85631116-85631138 TCTGGGACCAAGGAATGAGTAGG - Intergenic
1033344669 7:140517844-140517866 TCTGGGCCCCTGGAATGAGATGG + Intergenic
1034074620 7:148219756-148219778 TCTGGGCTCCAGCAACTTCTGGG - Intronic
1034496533 7:151426708-151426730 CCTCGGTCCCAGGAATTGCTGGG + Intergenic
1036376097 8:8200885-8200907 TCTCGGCCCCATAAATTAATTGG - Intergenic
1036853431 8:12222253-12222275 TCTCGGCCCCATAAATTAATTGG + Intergenic
1036874807 8:12464775-12464797 TCTCGGCCCCATAAATTAATTGG + Intergenic
1037309102 8:17536157-17536179 TCAGGGCCCCAGGAATACCAAGG - Intronic
1039905428 8:41782579-41782601 TCTGGGTGTCAGGAATTACCTGG - Intronic
1044981584 8:97721493-97721515 TGTGAGCCCAAGTAATTACTAGG - Intronic
1046724972 8:117664463-117664485 TCTGGGACTCAGGGGTTACTTGG - Intergenic
1047489344 8:125361906-125361928 TCTGGGTCCCAAGAATTCCAAGG - Intronic
1047550777 8:125870242-125870264 TGTGATCCCCAGGAATTACTGGG - Intergenic
1048185754 8:132239083-132239105 TAAGGGGCCCAGGAATTTCTTGG - Intronic
1048463433 8:134641633-134641655 TGTGGGACCCAGGAATTAAAAGG - Intronic
1048996684 8:139798942-139798964 TCGGGGCCACTGGAATTCCTTGG + Intronic
1049997755 9:1047692-1047714 TCGGGATCCCAGCAATTACTGGG - Intergenic
1050186449 9:2980117-2980139 GCTGGGCCCCAGCAGTTTCTTGG + Intergenic
1050346618 9:4695171-4695193 TCTGAGTCCCAGGAATCATTAGG + Intronic
1051332281 9:16034860-16034882 TCTGGGCCCAAGGGTTAACTTGG + Intronic
1052343116 9:27382396-27382418 TCAGGGCACCAGGAATAACTAGG - Intronic
1056384074 9:86081136-86081158 TCTGGGCCCCTCAAAGTACTGGG + Intronic
1056547102 9:87621979-87622001 TTTGGGCCCATGGAATGACTTGG + Intronic
1059868497 9:118544978-118545000 TCTCATCCCCAGGAATCACTGGG - Intergenic
1060679820 9:125552285-125552307 CCTGGGCCCCAGGAATCCCCTGG - Intronic
1186763845 X:12750585-12750607 TCTGAGCCCCACGAATTAAGGGG + Intergenic
1186902179 X:14068479-14068501 TCTGGGCCCCAGGCCTTCCTGGG + Intergenic
1187793899 X:22980277-22980299 TCTTGGCAGCAGGAATTTCTGGG - Intergenic
1189987812 X:46569768-46569790 CCTGGGCCCCAGGCATAGCTTGG - Intergenic
1191840886 X:65513053-65513075 TGTGGGCCCCAGGGTTGACTTGG + Intronic
1192700087 X:73459560-73459582 TCTTGGCTCCAGGCATTACTTGG - Intergenic
1194261420 X:91700181-91700203 CCTGGCCCCCAGAAATTTCTGGG - Intergenic
1200580070 Y:4938982-4939004 CCTGGCCCCCAGAAATTTCTGGG - Intergenic
1200752856 Y:6963091-6963113 TCTCGGCCCCATAAATTAATTGG + Intronic
1201150355 Y:11092250-11092272 TCTGGGCCCCAGGTATACCCTGG + Intergenic