ID: 910435873

View in Genome Browser
Species Human (GRCh38)
Location 1:87205234-87205256
Sequence GGTGGGACATGATGTTTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910435873_910435877 -1 Left 910435873 1:87205234-87205256 CCAATAAAACATCATGTCCCACC No data
Right 910435877 1:87205256-87205278 CAACATTGAAGTATTTATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910435873 Original CRISPR GGTGGGACATGATGTTTTAT TGG (reversed) Intergenic
No off target data available for this crispr