ID: 910438159

View in Genome Browser
Species Human (GRCh38)
Location 1:87226486-87226508
Sequence TTTTAAATGTAGATGATGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910438159_910438166 21 Left 910438159 1:87226486-87226508 CCTTGCATCATCTACATTTAAAA No data
Right 910438166 1:87226530-87226552 CTGTGATGCTGATGCTATTGAGG No data
910438159_910438160 -4 Left 910438159 1:87226486-87226508 CCTTGCATCATCTACATTTAAAA No data
Right 910438160 1:87226505-87226527 AAAATGAACCTCAGAAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910438159 Original CRISPR TTTTAAATGTAGATGATGCA AGG (reversed) Intergenic
No off target data available for this crispr