ID: 910438471

View in Genome Browser
Species Human (GRCh38)
Location 1:87228965-87228987
Sequence ACCTCCATGCTACAGTTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910438471_910438481 18 Left 910438471 1:87228965-87228987 CCCCCCAACTGTAGCATGGAGGT No data
Right 910438481 1:87229006-87229028 CCTCTCATGGGTTTGCTCTGAGG No data
910438471_910438476 5 Left 910438471 1:87228965-87228987 CCCCCCAACTGTAGCATGGAGGT No data
Right 910438476 1:87228993-87229015 TACTAATCCTTTCCCTCTCATGG No data
910438471_910438477 6 Left 910438471 1:87228965-87228987 CCCCCCAACTGTAGCATGGAGGT No data
Right 910438477 1:87228994-87229016 ACTAATCCTTTCCCTCTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910438471 Original CRISPR ACCTCCATGCTACAGTTGGG GGG (reversed) Intergenic
No off target data available for this crispr