ID: 910442668

View in Genome Browser
Species Human (GRCh38)
Location 1:87268478-87268500
Sequence CAGTGGGAATGGTAGGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910442664_910442668 -9 Left 910442664 1:87268464-87268486 CCTAGAGAGGGAGTCAGTGGGAA No data
Right 910442668 1:87268478-87268500 CAGTGGGAATGGTAGGAAATGGG No data
910442659_910442668 26 Left 910442659 1:87268429-87268451 CCTGAGACTTGGGGAGAAAGTTG No data
Right 910442668 1:87268478-87268500 CAGTGGGAATGGTAGGAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910442668 Original CRISPR CAGTGGGAATGGTAGGAAAT GGG Intergenic
No off target data available for this crispr