ID: 910442668 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:87268478-87268500 |
| Sequence | CAGTGGGAATGGTAGGAAAT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 910442664_910442668 | -9 | Left | 910442664 | 1:87268464-87268486 | CCTAGAGAGGGAGTCAGTGGGAA | No data | ||
| Right | 910442668 | 1:87268478-87268500 | CAGTGGGAATGGTAGGAAATGGG | No data | ||||
| 910442659_910442668 | 26 | Left | 910442659 | 1:87268429-87268451 | CCTGAGACTTGGGGAGAAAGTTG | No data | ||
| Right | 910442668 | 1:87268478-87268500 | CAGTGGGAATGGTAGGAAATGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 910442668 | Original CRISPR | CAGTGGGAATGGTAGGAAAT GGG | Intergenic | ||
| No off target data available for this crispr | |||||