ID: 910445328

View in Genome Browser
Species Human (GRCh38)
Location 1:87294169-87294191
Sequence CTACTCTTCATGAAGAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910445325_910445328 -2 Left 910445325 1:87294148-87294170 CCTCTTATTGAAAACACTTCCCT No data
Right 910445328 1:87294169-87294191 CTACTCTTCATGAAGAAAAATGG No data
910445323_910445328 2 Left 910445323 1:87294144-87294166 CCACCCTCTTATTGAAAACACTT No data
Right 910445328 1:87294169-87294191 CTACTCTTCATGAAGAAAAATGG No data
910445324_910445328 -1 Left 910445324 1:87294147-87294169 CCCTCTTATTGAAAACACTTCCC No data
Right 910445328 1:87294169-87294191 CTACTCTTCATGAAGAAAAATGG No data
910445322_910445328 3 Left 910445322 1:87294143-87294165 CCCACCCTCTTATTGAAAACACT No data
Right 910445328 1:87294169-87294191 CTACTCTTCATGAAGAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910445328 Original CRISPR CTACTCTTCATGAAGAAAAA TGG Intergenic
No off target data available for this crispr