ID: 910448933

View in Genome Browser
Species Human (GRCh38)
Location 1:87328242-87328264
Sequence GGTGAAGTGACCCGGGCGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 87}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910448933_910448936 -10 Left 910448933 1:87328242-87328264 CCAGGCGCCCGGGTCACTTCACC 0: 1
1: 0
2: 0
3: 6
4: 87
Right 910448936 1:87328255-87328277 TCACTTCACCCCACCTGATTCGG 0: 1
1: 0
2: 0
3: 5
4: 100
910448933_910448937 -9 Left 910448933 1:87328242-87328264 CCAGGCGCCCGGGTCACTTCACC 0: 1
1: 0
2: 0
3: 6
4: 87
Right 910448937 1:87328256-87328278 CACTTCACCCCACCTGATTCGGG 0: 1
1: 0
2: 2
3: 4
4: 134
910448933_910448942 13 Left 910448933 1:87328242-87328264 CCAGGCGCCCGGGTCACTTCACC 0: 1
1: 0
2: 0
3: 6
4: 87
Right 910448942 1:87328278-87328300 GCCCTTCCCTTCTCCTCTGTCGG 0: 1
1: 0
2: 3
3: 36
4: 375

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910448933 Original CRISPR GGTGAAGTGACCCGGGCGCC TGG (reversed) Intergenic