ID: 910448933

View in Genome Browser
Species Human (GRCh38)
Location 1:87328242-87328264
Sequence GGTGAAGTGACCCGGGCGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 87}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910448933_910448937 -9 Left 910448933 1:87328242-87328264 CCAGGCGCCCGGGTCACTTCACC 0: 1
1: 0
2: 0
3: 6
4: 87
Right 910448937 1:87328256-87328278 CACTTCACCCCACCTGATTCGGG 0: 1
1: 0
2: 2
3: 4
4: 134
910448933_910448936 -10 Left 910448933 1:87328242-87328264 CCAGGCGCCCGGGTCACTTCACC 0: 1
1: 0
2: 0
3: 6
4: 87
Right 910448936 1:87328255-87328277 TCACTTCACCCCACCTGATTCGG 0: 1
1: 0
2: 0
3: 5
4: 100
910448933_910448942 13 Left 910448933 1:87328242-87328264 CCAGGCGCCCGGGTCACTTCACC 0: 1
1: 0
2: 0
3: 6
4: 87
Right 910448942 1:87328278-87328300 GCCCTTCCCTTCTCCTCTGTCGG 0: 1
1: 0
2: 3
3: 36
4: 375

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910448933 Original CRISPR GGTGAAGTGACCCGGGCGCC TGG (reversed) Intergenic
903855755 1:26336820-26336842 GTGTAAGTGACCCGGGCTCCGGG - Exonic
904007803 1:27373085-27373107 GGAGAAGTGACCAGTGGGCCTGG + Intronic
906518955 1:46456208-46456230 GGGAAAGTGACACGGGCTCCAGG - Intergenic
910448933 1:87328242-87328264 GGTGAAGTGACCCGGGCGCCTGG - Intergenic
922488878 1:225999448-225999470 GGTCAAGTGAGCCGGGCGGCGGG + Intergenic
1076237543 10:128877055-128877077 GGTGAAGTGTGCCAGGCTCCTGG + Intergenic
1078866404 11:15302122-15302144 GGAGAAGTGACCTGGGCAGCTGG + Intergenic
1084792336 11:71482602-71482624 GGTGGAGTCACACGGGCACCTGG + Intronic
1089858906 11:121571645-121571667 GGTGAAGTGGCAGGGGAGCCGGG - Intronic
1091973838 12:4809830-4809852 GGGGAGGTGACCTGGGCGCTGGG - Exonic
1094460371 12:30691404-30691426 GGTGAAGTGACCCAGGCCACAGG - Intronic
1102096721 12:110247006-110247028 GGTGAAGGGGCCAGGGGGCCAGG + Intergenic
1102506474 12:113387571-113387593 GGTGAAGGGGTCCGGGCCCCAGG + Intronic
1114195039 14:20469578-20469600 GGTGCTGTGACCCGGGAACCTGG + Intronic
1119998480 14:79278508-79278530 GGTGAAGTCCCCTGGGCGCTGGG - Intronic
1121168699 14:91835881-91835903 GGAGCAGGGAGCCGGGCGCCCGG + Intronic
1121531757 14:94659191-94659213 GGGGAAGTGACCTGGGTGCCTGG + Intergenic
1124588075 15:31028398-31028420 GCTGGAGTGAGCCAGGCGCCGGG + Exonic
1125035628 15:35121172-35121194 AGTGACTTGACCCGGGCTCCAGG - Intergenic
1128374591 15:67066006-67066028 GGCGAAGTTGCCGGGGCGCCGGG - Exonic
1129328782 15:74816275-74816297 GGTGACGGGACTGGGGCGCCGGG + Exonic
1131950099 15:97672832-97672854 GGTGAGGTCACCCAGGCCCCAGG + Intergenic
1132544618 16:527585-527607 GGAGAAGTGGCCCGGGCGGTCGG + Intergenic
1132757584 16:1493578-1493600 GCTGCAGTCACCCGGGAGCCGGG + Exonic
1136245708 16:28974763-28974785 GGTCATGTGACGCGGGAGCCAGG - Exonic
1136336533 16:29613957-29613979 GGTGGGATGACGCGGGCGCCGGG - Intergenic
1139027329 16:62834330-62834352 GCCGAAGTGACCCCGGCCCCTGG + Intergenic
1142030796 16:87837558-87837580 GGTGCAGTGAGCCAGGCGGCTGG + Intronic
1142241682 16:88950312-88950334 GGTGAACTGACCCGGAAGACAGG - Exonic
1142241699 16:88950379-88950401 GGTGAACTGACCCGGAAGACAGG - Exonic
1142241735 16:88950514-88950536 GGTGAACTGACCCGGAAGACAGG - Exonic
1142304200 16:89276452-89276474 GGTGACGTGACCTGGAGGCCTGG - Intronic
1142808973 17:2386498-2386520 GGTGAGGTGGCCCAGGCCCCCGG - Exonic
1143128867 17:4663523-4663545 GTGGAAGTGACCCAGGCCCCGGG + Intergenic
1144806611 17:17972165-17972187 CGTGAAGTGGCACCGGCGCCCGG + Intronic
1147879691 17:43645912-43645934 GGTAAAGTGATTTGGGCGCCTGG + Intronic
1151704980 17:75762745-75762767 GAAGAAGTGGCCCGGGCGCTGGG - Exonic
1151858274 17:76737971-76737993 GGTCAGGTGACCCGGTCGCCTGG + Exonic
1152387054 17:79980923-79980945 TGTGACGTGACCTGGGCCCCGGG + Intronic
1159903037 18:74065976-74065998 GGTGGAGTGACTGGGGTGCCTGG + Intergenic
1160497222 18:79382766-79382788 GGTGAGGTGGCCCGGAAGCCTGG - Intergenic
1161808975 19:6460516-6460538 GGCTCAGTGACCCGGGCGCGGGG + Intronic
1161946806 19:7442465-7442487 GCTCAAGTGACCCGCCCGCCTGG + Intronic
1162292872 19:9792451-9792473 GGTGAGGGGAACCGGGGGCCGGG - Intronic
1168319636 19:55501151-55501173 GGAGGAGCTACCCGGGCGCCGGG - Exonic
926062274 2:9812081-9812103 GGGGAACTGGCCCGGCCGCCGGG - Intergenic
928203128 2:29264112-29264134 GGGGGAGTGACCAGGGTGCCTGG - Intronic
928554080 2:32404721-32404743 GGTGCAGTGAGCCGTGAGCCCGG - Intronic
932239056 2:70142764-70142786 GGTGACGTGTCCCGTGCGCCAGG + Intergenic
932779184 2:74549347-74549369 GGTGAGGGGCCGCGGGCGCCGGG - Exonic
935071107 2:99694450-99694472 GCTGAGGTCACCCAGGCGCCAGG + Intronic
936561488 2:113542472-113542494 GGAGAAGAGTCCAGGGCGCCCGG - Intergenic
937345580 2:121123431-121123453 GGGGAGGTGAGCCGGGTGCCAGG + Intergenic
942471950 2:176269594-176269616 GGGGCAGGCACCCGGGCGCCGGG + Exonic
946432697 2:219633979-219634001 GGTGAGGAGGGCCGGGCGCCGGG + Exonic
949000510 2:241610361-241610383 GGTGGCGTGACCCTGGCGCTGGG - Intronic
1176126893 20:63479521-63479543 GGGGAAGAGACACGGGCGCTGGG + Intergenic
1176145619 20:63564084-63564106 GGTGCAGTGACAGGGGCACCCGG + Exonic
1179657322 21:42853378-42853400 GGTGAAGGGAGCCGGGTGCCAGG - Intronic
1180922008 22:19525823-19525845 GGAGAAGGGAACCGGGCCCCAGG - Intronic
1181668629 22:24415098-24415120 GGTGAAGGGCCCAGGGCGCTGGG - Exonic
1182035523 22:27195409-27195431 CGGGAAGTGACTCGGGCGCGGGG + Intergenic
950399719 3:12760521-12760543 GCTGAAGTGAGCGGGGGGCCAGG - Intronic
952898599 3:38095398-38095420 GGTGCAGGGACCCGAGGGCCAGG + Intronic
955770314 3:62378600-62378622 GGTGCAGTGGGCCGGGCGCTCGG - Intergenic
985023913 4:185720498-185720520 GGTGAAGTGACCTGGGCCTAAGG - Intronic
992894731 5:81236094-81236116 GCTGAAGTAACCCAGACGCCAGG - Intronic
998820787 5:146056004-146056026 GGTGTAGAGACCAGGGCTCCGGG - Exonic
1000020697 5:157316661-157316683 GCTGAAGTGACCAGAGGGCCCGG - Intronic
1001085793 5:168699252-168699274 GGGGAAGAGAACCGGGAGCCTGG + Intronic
1002133187 5:177093569-177093591 GGGGCAGGGACGCGGGCGCCGGG + Intronic
1002461950 5:179378292-179378314 GGTGAGCAGCCCCGGGCGCCAGG - Intergenic
1011901410 6:92302605-92302627 GGTGAAGTCTCCCTGGCCCCGGG - Intergenic
1018955549 6:168407958-168407980 GGTCAAGTGACCAGGGTGCAGGG - Intergenic
1019452154 7:1104668-1104690 GGAGACGTGAGCCGGGTGCCTGG + Intronic
1019636637 7:2079471-2079493 GGAGAAGTGACCGGGAGGCCAGG - Intronic
1022675413 7:32495265-32495287 GCTTACGTGACCCGGGCGGCTGG - Intronic
1027239553 7:76318268-76318290 GGTGCAGAGGCCAGGGCGCCCGG - Intergenic
1031629696 7:124032357-124032379 GCAGTAGGGACCCGGGCGCCGGG + Exonic
1032781978 7:135170806-135170828 CCGGAAGTGTCCCGGGCGCCGGG - Intergenic
1035795075 8:2348422-2348444 GGTTAAGTGATTCGGTCGCCTGG - Intergenic
1036359256 8:8065815-8065837 GAGTAAGTGACGCGGGCGCCGGG + Intergenic
1036891702 8:12601137-12601159 GAGTAAGTGACGCGGGCGCCGGG - Intergenic
1048307854 8:133296344-133296366 GGAGAAGTGACCTGGGCGAGAGG - Intronic
1049891197 9:72868-72890 GGAGAAGAGTCCAGGGCGCCCGG + Intergenic
1050305192 9:4299448-4299470 GGGGAAGGGACCCGCACGCCGGG - Exonic
1052678249 9:31654877-31654899 GGTGAAATGACCCTGACACCAGG + Intergenic
1054695798 9:68357648-68357670 GGAGAAGAGTCCAGGGCGCCCGG - Intronic
1060056347 9:120417219-120417241 GGTGCAGTGCCGTGGGCGCCAGG - Intronic
1060429998 9:123542778-123542800 GGTCAAGTGACCCTGGCCTCTGG + Intronic
1193305858 X:79950178-79950200 GGTGAAGTCCCCCAGGCTCCAGG - Intergenic
1200000206 X:153056291-153056313 GGTGACGTCACCCGGGGACCTGG + Intergenic
1200003126 X:153072264-153072286 GGTGACGTCACCCGGGGTCCTGG + Intergenic
1200004597 X:153077745-153077767 GGTGACGTCACCCGGGGTCCTGG - Intergenic