ID: 910448937

View in Genome Browser
Species Human (GRCh38)
Location 1:87328256-87328278
Sequence CACTTCACCCCACCTGATTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 134}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910448932_910448937 -8 Left 910448932 1:87328241-87328263 CCCAGGCGCCCGGGTCACTTCAC 0: 1
1: 0
2: 1
3: 3
4: 192
Right 910448937 1:87328256-87328278 CACTTCACCCCACCTGATTCGGG 0: 1
1: 0
2: 2
3: 4
4: 134
910448929_910448937 -2 Left 910448929 1:87328235-87328257 CCCGGCCCCAGGCGCCCGGGTCA 0: 1
1: 0
2: 1
3: 33
4: 293
Right 910448937 1:87328256-87328278 CACTTCACCCCACCTGATTCGGG 0: 1
1: 0
2: 2
3: 4
4: 134
910448933_910448937 -9 Left 910448933 1:87328242-87328264 CCAGGCGCCCGGGTCACTTCACC 0: 1
1: 0
2: 0
3: 6
4: 87
Right 910448937 1:87328256-87328278 CACTTCACCCCACCTGATTCGGG 0: 1
1: 0
2: 2
3: 4
4: 134
910448918_910448937 29 Left 910448918 1:87328204-87328226 CCCGGGTCGCGAAGGGCAGCCCA 0: 1
1: 0
2: 1
3: 8
4: 96
Right 910448937 1:87328256-87328278 CACTTCACCCCACCTGATTCGGG 0: 1
1: 0
2: 2
3: 4
4: 134
910448931_910448937 -7 Left 910448931 1:87328240-87328262 CCCCAGGCGCCCGGGTCACTTCA 0: 1
1: 0
2: 0
3: 7
4: 74
Right 910448937 1:87328256-87328278 CACTTCACCCCACCTGATTCGGG 0: 1
1: 0
2: 2
3: 4
4: 134
910448919_910448937 28 Left 910448919 1:87328205-87328227 CCGGGTCGCGAAGGGCAGCCCAA 0: 1
1: 0
2: 0
3: 1
4: 43
Right 910448937 1:87328256-87328278 CACTTCACCCCACCTGATTCGGG 0: 1
1: 0
2: 2
3: 4
4: 134
910448924_910448937 9 Left 910448924 1:87328224-87328246 CCAAGCGGGTCCCCGGCCCCAGG 0: 1
1: 0
2: 5
3: 21
4: 294
Right 910448937 1:87328256-87328278 CACTTCACCCCACCTGATTCGGG 0: 1
1: 0
2: 2
3: 4
4: 134
910448930_910448937 -3 Left 910448930 1:87328236-87328258 CCGGCCCCAGGCGCCCGGGTCAC 0: 1
1: 0
2: 0
3: 34
4: 506
Right 910448937 1:87328256-87328278 CACTTCACCCCACCTGATTCGGG 0: 1
1: 0
2: 2
3: 4
4: 134
910448928_910448937 -1 Left 910448928 1:87328234-87328256 CCCCGGCCCCAGGCGCCCGGGTC 0: 1
1: 0
2: 1
3: 37
4: 360
Right 910448937 1:87328256-87328278 CACTTCACCCCACCTGATTCGGG 0: 1
1: 0
2: 2
3: 4
4: 134
910448923_910448937 10 Left 910448923 1:87328223-87328245 CCCAAGCGGGTCCCCGGCCCCAG 0: 1
1: 0
2: 0
3: 18
4: 159
Right 910448937 1:87328256-87328278 CACTTCACCCCACCTGATTCGGG 0: 1
1: 0
2: 2
3: 4
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910448937 Original CRISPR CACTTCACCCCACCTGATTC GGG Intergenic