ID: 910448942

View in Genome Browser
Species Human (GRCh38)
Location 1:87328278-87328300
Sequence GCCCTTCCCTTCTCCTCTGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 375}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910448939_910448942 -9 Left 910448939 1:87328264-87328286 CCCACCTGATTCGGGCCCTTCCC 0: 1
1: 0
2: 2
3: 8
4: 124
Right 910448942 1:87328278-87328300 GCCCTTCCCTTCTCCTCTGTCGG 0: 1
1: 0
2: 3
3: 36
4: 375
910448930_910448942 19 Left 910448930 1:87328236-87328258 CCGGCCCCAGGCGCCCGGGTCAC 0: 1
1: 0
2: 0
3: 34
4: 506
Right 910448942 1:87328278-87328300 GCCCTTCCCTTCTCCTCTGTCGG 0: 1
1: 0
2: 3
3: 36
4: 375
910448928_910448942 21 Left 910448928 1:87328234-87328256 CCCCGGCCCCAGGCGCCCGGGTC 0: 1
1: 0
2: 1
3: 37
4: 360
Right 910448942 1:87328278-87328300 GCCCTTCCCTTCTCCTCTGTCGG 0: 1
1: 0
2: 3
3: 36
4: 375
910448929_910448942 20 Left 910448929 1:87328235-87328257 CCCGGCCCCAGGCGCCCGGGTCA 0: 1
1: 0
2: 1
3: 33
4: 293
Right 910448942 1:87328278-87328300 GCCCTTCCCTTCTCCTCTGTCGG 0: 1
1: 0
2: 3
3: 36
4: 375
910448933_910448942 13 Left 910448933 1:87328242-87328264 CCAGGCGCCCGGGTCACTTCACC 0: 1
1: 0
2: 0
3: 6
4: 87
Right 910448942 1:87328278-87328300 GCCCTTCCCTTCTCCTCTGTCGG 0: 1
1: 0
2: 3
3: 36
4: 375
910448931_910448942 15 Left 910448931 1:87328240-87328262 CCCCAGGCGCCCGGGTCACTTCA 0: 1
1: 0
2: 0
3: 7
4: 74
Right 910448942 1:87328278-87328300 GCCCTTCCCTTCTCCTCTGTCGG 0: 1
1: 0
2: 3
3: 36
4: 375
910448935_910448942 5 Left 910448935 1:87328250-87328272 CCGGGTCACTTCACCCCACCTGA 0: 1
1: 0
2: 3
3: 9
4: 169
Right 910448942 1:87328278-87328300 GCCCTTCCCTTCTCCTCTGTCGG 0: 1
1: 0
2: 3
3: 36
4: 375
910448934_910448942 6 Left 910448934 1:87328249-87328271 CCCGGGTCACTTCACCCCACCTG 0: 1
1: 0
2: 2
3: 30
4: 318
Right 910448942 1:87328278-87328300 GCCCTTCCCTTCTCCTCTGTCGG 0: 1
1: 0
2: 3
3: 36
4: 375
910448940_910448942 -10 Left 910448940 1:87328265-87328287 CCACCTGATTCGGGCCCTTCCCT 0: 1
1: 0
2: 1
3: 9
4: 154
Right 910448942 1:87328278-87328300 GCCCTTCCCTTCTCCTCTGTCGG 0: 1
1: 0
2: 3
3: 36
4: 375
910448938_910448942 -8 Left 910448938 1:87328263-87328285 CCCCACCTGATTCGGGCCCTTCC 0: 1
1: 0
2: 1
3: 7
4: 122
Right 910448942 1:87328278-87328300 GCCCTTCCCTTCTCCTCTGTCGG 0: 1
1: 0
2: 3
3: 36
4: 375
910448932_910448942 14 Left 910448932 1:87328241-87328263 CCCAGGCGCCCGGGTCACTTCAC 0: 1
1: 0
2: 1
3: 3
4: 192
Right 910448942 1:87328278-87328300 GCCCTTCCCTTCTCCTCTGTCGG 0: 1
1: 0
2: 3
3: 36
4: 375

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910448942 Original CRISPR GCCCTTCCCTTCTCCTCTGT CGG Intergenic