ID: 910449611

View in Genome Browser
Species Human (GRCh38)
Location 1:87331892-87331914
Sequence TTTCCTTCCAGCAGCTCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 182}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910449596_910449611 17 Left 910449596 1:87331852-87331874 CCCTCTCCCCCTCAGCCTCCTTC 0: 1
1: 0
2: 16
3: 474
4: 3998
Right 910449611 1:87331892-87331914 TTTCCTTCCAGCAGCTCCGCGGG 0: 1
1: 0
2: 0
3: 22
4: 182
910449604_910449611 -5 Left 910449604 1:87331874-87331896 CCCGCCCTTGCCCTGCTGTTTCC 0: 1
1: 1
2: 3
3: 61
4: 613
Right 910449611 1:87331892-87331914 TTTCCTTCCAGCAGCTCCGCGGG 0: 1
1: 0
2: 0
3: 22
4: 182
910449593_910449611 28 Left 910449593 1:87331841-87331863 CCTCCCTTCTTCCCTCTCCCCCT 0: 1
1: 13
2: 228
3: 2720
4: 15964
Right 910449611 1:87331892-87331914 TTTCCTTCCAGCAGCTCCGCGGG 0: 1
1: 0
2: 0
3: 22
4: 182
910449606_910449611 -9 Left 910449606 1:87331878-87331900 CCCTTGCCCTGCTGTTTCCTTCC 0: 1
1: 0
2: 6
3: 86
4: 719
Right 910449611 1:87331892-87331914 TTTCCTTCCAGCAGCTCCGCGGG 0: 1
1: 0
2: 0
3: 22
4: 182
910449598_910449611 11 Left 910449598 1:87331858-87331880 CCCCCTCAGCCTCCTTCCCGCCC 0: 1
1: 0
2: 9
3: 159
4: 1621
Right 910449611 1:87331892-87331914 TTTCCTTCCAGCAGCTCCGCGGG 0: 1
1: 0
2: 0
3: 22
4: 182
910449607_910449611 -10 Left 910449607 1:87331879-87331901 CCTTGCCCTGCTGTTTCCTTCCA 0: 1
1: 0
2: 7
3: 70
4: 718
Right 910449611 1:87331892-87331914 TTTCCTTCCAGCAGCTCCGCGGG 0: 1
1: 0
2: 0
3: 22
4: 182
910449605_910449611 -6 Left 910449605 1:87331875-87331897 CCGCCCTTGCCCTGCTGTTTCCT 0: 1
1: 0
2: 10
3: 80
4: 804
Right 910449611 1:87331892-87331914 TTTCCTTCCAGCAGCTCCGCGGG 0: 1
1: 0
2: 0
3: 22
4: 182
910449599_910449611 10 Left 910449599 1:87331859-87331881 CCCCTCAGCCTCCTTCCCGCCCT 0: 1
1: 0
2: 9
3: 164
4: 2167
Right 910449611 1:87331892-87331914 TTTCCTTCCAGCAGCTCCGCGGG 0: 1
1: 0
2: 0
3: 22
4: 182
910449600_910449611 9 Left 910449600 1:87331860-87331882 CCCTCAGCCTCCTTCCCGCCCTT 0: 1
1: 0
2: 1
3: 75
4: 759
Right 910449611 1:87331892-87331914 TTTCCTTCCAGCAGCTCCGCGGG 0: 1
1: 0
2: 0
3: 22
4: 182
910449594_910449611 25 Left 910449594 1:87331844-87331866 CCCTTCTTCCCTCTCCCCCTCAG 0: 1
1: 0
2: 12
3: 192
4: 1967
Right 910449611 1:87331892-87331914 TTTCCTTCCAGCAGCTCCGCGGG 0: 1
1: 0
2: 0
3: 22
4: 182
910449602_910449611 2 Left 910449602 1:87331867-87331889 CCTCCTTCCCGCCCTTGCCCTGC 0: 1
1: 0
2: 9
3: 125
4: 1036
Right 910449611 1:87331892-87331914 TTTCCTTCCAGCAGCTCCGCGGG 0: 1
1: 0
2: 0
3: 22
4: 182
910449597_910449611 16 Left 910449597 1:87331853-87331875 CCTCTCCCCCTCAGCCTCCTTCC 0: 1
1: 2
2: 22
3: 297
4: 2610
Right 910449611 1:87331892-87331914 TTTCCTTCCAGCAGCTCCGCGGG 0: 1
1: 0
2: 0
3: 22
4: 182
910449603_910449611 -1 Left 910449603 1:87331870-87331892 CCTTCCCGCCCTTGCCCTGCTGT 0: 1
1: 0
2: 3
3: 44
4: 483
Right 910449611 1:87331892-87331914 TTTCCTTCCAGCAGCTCCGCGGG 0: 1
1: 0
2: 0
3: 22
4: 182
910449595_910449611 24 Left 910449595 1:87331845-87331867 CCTTCTTCCCTCTCCCCCTCAGC 0: 1
1: 1
2: 15
3: 218
4: 1890
Right 910449611 1:87331892-87331914 TTTCCTTCCAGCAGCTCCGCGGG 0: 1
1: 0
2: 0
3: 22
4: 182
910449601_910449611 8 Left 910449601 1:87331861-87331883 CCTCAGCCTCCTTCCCGCCCTTG 0: 1
1: 0
2: 3
3: 70
4: 691
Right 910449611 1:87331892-87331914 TTTCCTTCCAGCAGCTCCGCGGG 0: 1
1: 0
2: 0
3: 22
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910449611 Original CRISPR TTTCCTTCCAGCAGCTCCGC GGG Intronic