ID: 910449611

View in Genome Browser
Species Human (GRCh38)
Location 1:87331892-87331914
Sequence TTTCCTTCCAGCAGCTCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 182}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910449605_910449611 -6 Left 910449605 1:87331875-87331897 CCGCCCTTGCCCTGCTGTTTCCT 0: 1
1: 0
2: 10
3: 80
4: 804
Right 910449611 1:87331892-87331914 TTTCCTTCCAGCAGCTCCGCGGG 0: 1
1: 0
2: 0
3: 22
4: 182
910449602_910449611 2 Left 910449602 1:87331867-87331889 CCTCCTTCCCGCCCTTGCCCTGC 0: 1
1: 0
2: 9
3: 125
4: 1036
Right 910449611 1:87331892-87331914 TTTCCTTCCAGCAGCTCCGCGGG 0: 1
1: 0
2: 0
3: 22
4: 182
910449601_910449611 8 Left 910449601 1:87331861-87331883 CCTCAGCCTCCTTCCCGCCCTTG 0: 1
1: 0
2: 3
3: 70
4: 691
Right 910449611 1:87331892-87331914 TTTCCTTCCAGCAGCTCCGCGGG 0: 1
1: 0
2: 0
3: 22
4: 182
910449599_910449611 10 Left 910449599 1:87331859-87331881 CCCCTCAGCCTCCTTCCCGCCCT 0: 1
1: 0
2: 9
3: 164
4: 2167
Right 910449611 1:87331892-87331914 TTTCCTTCCAGCAGCTCCGCGGG 0: 1
1: 0
2: 0
3: 22
4: 182
910449606_910449611 -9 Left 910449606 1:87331878-87331900 CCCTTGCCCTGCTGTTTCCTTCC 0: 1
1: 0
2: 6
3: 86
4: 719
Right 910449611 1:87331892-87331914 TTTCCTTCCAGCAGCTCCGCGGG 0: 1
1: 0
2: 0
3: 22
4: 182
910449600_910449611 9 Left 910449600 1:87331860-87331882 CCCTCAGCCTCCTTCCCGCCCTT 0: 1
1: 0
2: 1
3: 75
4: 759
Right 910449611 1:87331892-87331914 TTTCCTTCCAGCAGCTCCGCGGG 0: 1
1: 0
2: 0
3: 22
4: 182
910449598_910449611 11 Left 910449598 1:87331858-87331880 CCCCCTCAGCCTCCTTCCCGCCC 0: 1
1: 0
2: 9
3: 159
4: 1621
Right 910449611 1:87331892-87331914 TTTCCTTCCAGCAGCTCCGCGGG 0: 1
1: 0
2: 0
3: 22
4: 182
910449603_910449611 -1 Left 910449603 1:87331870-87331892 CCTTCCCGCCCTTGCCCTGCTGT 0: 1
1: 0
2: 3
3: 44
4: 483
Right 910449611 1:87331892-87331914 TTTCCTTCCAGCAGCTCCGCGGG 0: 1
1: 0
2: 0
3: 22
4: 182
910449593_910449611 28 Left 910449593 1:87331841-87331863 CCTCCCTTCTTCCCTCTCCCCCT 0: 1
1: 13
2: 228
3: 2720
4: 15964
Right 910449611 1:87331892-87331914 TTTCCTTCCAGCAGCTCCGCGGG 0: 1
1: 0
2: 0
3: 22
4: 182
910449604_910449611 -5 Left 910449604 1:87331874-87331896 CCCGCCCTTGCCCTGCTGTTTCC 0: 1
1: 1
2: 3
3: 61
4: 613
Right 910449611 1:87331892-87331914 TTTCCTTCCAGCAGCTCCGCGGG 0: 1
1: 0
2: 0
3: 22
4: 182
910449597_910449611 16 Left 910449597 1:87331853-87331875 CCTCTCCCCCTCAGCCTCCTTCC 0: 1
1: 2
2: 22
3: 297
4: 2610
Right 910449611 1:87331892-87331914 TTTCCTTCCAGCAGCTCCGCGGG 0: 1
1: 0
2: 0
3: 22
4: 182
910449596_910449611 17 Left 910449596 1:87331852-87331874 CCCTCTCCCCCTCAGCCTCCTTC 0: 1
1: 0
2: 16
3: 474
4: 3998
Right 910449611 1:87331892-87331914 TTTCCTTCCAGCAGCTCCGCGGG 0: 1
1: 0
2: 0
3: 22
4: 182
910449595_910449611 24 Left 910449595 1:87331845-87331867 CCTTCTTCCCTCTCCCCCTCAGC 0: 1
1: 1
2: 15
3: 218
4: 1890
Right 910449611 1:87331892-87331914 TTTCCTTCCAGCAGCTCCGCGGG 0: 1
1: 0
2: 0
3: 22
4: 182
910449607_910449611 -10 Left 910449607 1:87331879-87331901 CCTTGCCCTGCTGTTTCCTTCCA 0: 1
1: 0
2: 7
3: 70
4: 718
Right 910449611 1:87331892-87331914 TTTCCTTCCAGCAGCTCCGCGGG 0: 1
1: 0
2: 0
3: 22
4: 182
910449594_910449611 25 Left 910449594 1:87331844-87331866 CCCTTCTTCCCTCTCCCCCTCAG 0: 1
1: 0
2: 12
3: 192
4: 1967
Right 910449611 1:87331892-87331914 TTTCCTTCCAGCAGCTCCGCGGG 0: 1
1: 0
2: 0
3: 22
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910449611 Original CRISPR TTTCCTTCCAGCAGCTCCGC GGG Intronic
900210896 1:1455449-1455471 TTCCCCTCCAGCAGGTCAGCCGG + Exonic
901437368 1:9255840-9255862 CCTCCTTCCAGAAGCTCAGCCGG + Intronic
901626749 1:10629246-10629268 TTGGCTTCCAGCAGCTGCCCAGG + Intronic
902697958 1:18153148-18153170 TTTGCTCCCAGCCGCTCTGCTGG + Intronic
902778577 1:18690376-18690398 TATGCTTCCCGCAGCTCCCCAGG + Intronic
903363263 1:22790413-22790435 CTTCCTGCCAGCAGGTCTGCTGG + Intronic
903428200 1:23270555-23270577 TTTCCTTCCAGAGGCTCCAGGGG - Intergenic
903511105 1:23875420-23875442 TGTCCTCCCACCAACTCCGCCGG - Exonic
909803149 1:79839995-79840017 TTTCCTCACAGCAACTCAGCAGG - Intergenic
910449611 1:87331892-87331914 TTTCCTTCCAGCAGCTCCGCGGG + Intronic
910646890 1:89524453-89524475 GCTCTTTCCAGCTGCTCCGCGGG + Intergenic
914197258 1:145454009-145454031 TGACCTTCCAGCCGTTCCGCAGG + Intergenic
914878372 1:151529339-151529361 TTTCCTTCCAGGAGCTGCTCCGG + Exonic
915518668 1:156428891-156428913 TTTCCTTCCTGCCTCTCCTCTGG + Intronic
915830134 1:159120726-159120748 TTTCCTTCCAACAGTCACGCTGG - Intronic
918216125 1:182392679-182392701 TTTCCTTTCAGCTGCTCCGGGGG - Intergenic
918917968 1:190669916-190669938 TTGCCTTCAAGCACCTCAGCAGG + Intergenic
920750171 1:208666818-208666840 TTTGCTTCCATCAGCCCAGCAGG - Intergenic
922504143 1:226116724-226116746 TTTCCCTGCAGCACCTCAGCAGG - Intergenic
922575718 1:226659544-226659566 TCTCCTTCCAGCAGATCCCCTGG + Intronic
923113334 1:230910608-230910630 TGTCCTCACAGCAGCTCTGCTGG - Intronic
923836418 1:237616003-237616025 TTTCCTACCAGCAGCCACACTGG - Intronic
923882919 1:238123331-238123353 TGTCCTCCCAGGAGCTTCGCTGG + Intergenic
924826934 1:247549672-247549694 TTTCCATCCATCAGCTTCGTGGG + Intronic
1062829428 10:595708-595730 TTTCCTACATGCAGCTCCACAGG - Intronic
1063131359 10:3180487-3180509 TTCCCTTCCGGAAGCTCTGCTGG + Intergenic
1064117306 10:12589537-12589559 TTTCATTTCTGCAGCTCTGCTGG - Intronic
1064701604 10:18027484-18027506 TTTACCTCCAGGAGCTCCACGGG - Intronic
1068560531 10:58510633-58510655 TTTCCTTGTACCAGCTACGCTGG + Intergenic
1069334650 10:67334108-67334130 TTTCCTTTCAGCAGCTTGGGTGG - Intronic
1069460972 10:68594449-68594471 ATTCCTTCCAGCAGTTCTGCTGG - Intronic
1073353341 10:102835193-102835215 TCTCCCTCCAGCAGCTCCTGTGG + Intronic
1073511873 10:104047530-104047552 TTTTCCTCCAGCAGCTCAGCAGG - Intronic
1076284596 10:129280940-129280962 TGTCCTTCCAGAAGCCCCGAAGG - Intergenic
1076590369 10:131578290-131578312 TCTCCCTCCAGCAGCCCCCCAGG - Intergenic
1076667523 10:132101697-132101719 CTTCCTTCCAGCGGCACCCCAGG - Intergenic
1076843681 10:133058613-133058635 TTTCCTCCCAGCCCCTCCACAGG + Intergenic
1079753804 11:24230271-24230293 TGTCCTCCCAGCAGCTCTACAGG + Intergenic
1080130931 11:28793320-28793342 TTTCCCCCCAGGAGCTCCACAGG + Intergenic
1080819935 11:35795953-35795975 AATCCTTCCAGCAGCTCTTCTGG + Intronic
1081227979 11:40548478-40548500 TTTCCTTCTAGGAGCTGTGCAGG - Intronic
1082080373 11:48008101-48008123 TTTCCCTCCAGCAGATCACCTGG - Intronic
1084165236 11:67372442-67372464 TTTCCTTCGAGGGGCTCGGCCGG + Intronic
1084682987 11:70677931-70677953 TTCCCTTCCACCATCTCCACTGG + Intronic
1087602870 11:100338731-100338753 TTTCCTGCCAGCAGCTGAACTGG - Intronic
1087860171 11:103143567-103143589 TTTCCTTCTAGAAGCTCTGCTGG + Intronic
1091327966 11:134706061-134706083 TTTCCTTGGATCAGCCCCGCTGG - Intergenic
1091501048 12:1018334-1018356 TGTACTCCCAGCAGCTCCACAGG - Intronic
1092526384 12:9312562-9312584 TTCCCTGCCTGCAGCTCCCCCGG - Intergenic
1092540887 12:9419223-9419245 TTCCCTGCCTGCAGCTCCCCCGG + Intergenic
1093383409 12:18521792-18521814 TCTCCTCCCAGGAGCTCAGCAGG + Intronic
1093399336 12:18725466-18725488 TTTTCTTCCAGCTGCTCCTCTGG - Intronic
1095915651 12:47475277-47475299 TTTACTTCCAGCAGATCTCCAGG + Intergenic
1096938467 12:55311801-55311823 TTTCTTTCAAGAAGATCCGCTGG - Intergenic
1096978943 12:55717390-55717412 TTTCCTGCCAGCTGCTCCCCAGG - Intronic
1097289086 12:57898829-57898851 GATCCTTCCAGCAGCCCTGCAGG + Intergenic
1099652474 12:85445795-85445817 TTTCCTTCTTGCAGCTGCCCTGG - Intergenic
1101755838 12:107620028-107620050 TCGCCTTCCAGCAGCACCGCAGG + Exonic
1102965665 12:117123595-117123617 CATCCTCCCAGCAGCCCCGCAGG - Intergenic
1103976110 12:124703795-124703817 GTTCCTTCCAGAAGCTCCAGAGG - Intergenic
1103999114 12:124849175-124849197 TTAGCTTCCAGCAGCTCAGGTGG - Intronic
1104415661 12:128595065-128595087 TTTCCTTCCAGCTTCACCGATGG - Intronic
1106524334 13:30526990-30527012 TTTACATCCTGCAGCTACGCAGG + Intronic
1108056743 13:46492874-46492896 TTTCTTTAGAGCAACTCCGCAGG + Intergenic
1110790776 13:79584460-79584482 TTTACTTCCAGGAGCCCCACTGG + Intergenic
1118222580 14:63869016-63869038 TAACCTTCAAGCAGCTCCGAAGG + Intronic
1122226158 14:100281361-100281383 CTTCCTCCCAGCTGCTCTGCTGG + Exonic
1122307369 14:100774238-100774260 CTTCCTTCCAACAGCTCCTGGGG - Intergenic
1123112282 14:105878601-105878623 TTTCTTTTCATCAGCTCCACGGG + Intergenic
1125531386 15:40415789-40415811 TTACCTTCCAGCAGCTTCTTCGG - Intronic
1125589743 15:40846783-40846805 TATCCTTCCAGTAGCTCTCCTGG + Intronic
1126284631 15:46996833-46996855 CCTCCTCCCAGGAGCTCCGCAGG + Intergenic
1126808225 15:52374716-52374738 TCTCCTTCCAGAAGCTCCAGGGG - Intronic
1127565436 15:60183739-60183761 TTTCTTTCCATCAGATCTGCCGG + Intergenic
1127601379 15:60540690-60540712 TTTCTTTCCATGAGCTCCGATGG + Intronic
1127632946 15:60843120-60843142 TTTCCTTGCAGCAGAACAGCAGG - Intronic
1129689840 15:77706910-77706932 TCTCCTGCCAGCATCTCCTCTGG - Intronic
1130158992 15:81380329-81380351 TTTCATTCCAGCAGCTTCTCGGG + Intergenic
1130990064 15:88870888-88870910 TTTCCTTCCTGCAGAACCTCAGG - Intronic
1134364255 16:13562133-13562155 TTTCCTTCCAGCACCTAATCAGG + Intergenic
1135470011 16:22721873-22721895 TTTCCTTTCACCAGCTGCTCTGG + Intergenic
1135590363 16:23700827-23700849 CTCCCTCCCAGCAGCTCCCCAGG - Intronic
1136129444 16:28211100-28211122 TTTGCCTCCTGCAGCTCCTCCGG - Intronic
1136609582 16:31358072-31358094 GTGCCTTCCAGCACCTCCGTGGG + Intronic
1136654406 16:31701172-31701194 TTTCCTTCAAGCCCCTCCGGTGG - Intergenic
1137686221 16:50388765-50388787 TTTCCTTCCAGAAGCACAGTTGG - Intergenic
1141432345 16:83976876-83976898 TGTGCTCCCAGCAGCTCTGCTGG - Intronic
1141854503 16:86671947-86671969 TCTCCCTCCAGCAGTTCCTCGGG + Intergenic
1143116257 17:4583450-4583472 TCTCCTTCCTGCAGGTCAGCTGG + Intergenic
1143462402 17:7112341-7112363 TTTCCCTCCAGCAGCCCGGGTGG - Intronic
1146856346 17:36260532-36260554 TTTCCTTCCTTCAGGTCCCCAGG + Intronic
1146864270 17:36327843-36327865 TTTCCTTCCTTCAGGTCCCCAGG - Intronic
1146872256 17:36384443-36384465 TTTCCTTCCTTCAGGTCCCCAGG + Intronic
1146953509 17:36922552-36922574 TCTGCTTCCAGCAGCTCCTGGGG - Intergenic
1147102610 17:38188576-38188598 TTTCCTTCCTTCAGGTCCCCAGG + Intergenic
1148875766 17:50686318-50686340 TTTCCTCGCAGCAGTTCAGCTGG + Intronic
1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG + Intronic
1151882234 17:76902772-76902794 TCTCCTGACAGCAGCTCTGCTGG + Intronic
1152760779 17:82106023-82106045 TTTCATGCCAGCACCTCCTCTGG + Intronic
1153803295 18:8690402-8690424 TTTCCTTCCAGCCACTTCTCTGG + Intergenic
1153825216 18:8868578-8868600 TGTCCTTCCAGCAGCTGCTCTGG - Intergenic
1154305856 18:13230296-13230318 TTTCGTTACAGCAGCACGGCTGG + Intronic
1160340226 18:78083151-78083173 TTTCCTTCCAGGATCACAGCTGG - Intergenic
1160883132 19:1331587-1331609 TTCCCTTCCAGCCCCTCCCCAGG - Intergenic
1161530405 19:4785519-4785541 TTTTTTTCCTGCAGCCCCGCCGG - Intergenic
1161617773 19:5281739-5281761 CTTCCTTCCAGCAGCTCCAGAGG - Intronic
1162142545 19:8593255-8593277 TTTCCTTCCAGAAACTCAGAAGG - Intronic
1163834581 19:19565353-19565375 TTTCCTTCCAGCCCCTTCCCAGG - Intronic
1164425933 19:28141937-28141959 TCTCCTCCCAGTAGCTCAGCAGG + Intergenic
1165095588 19:33408082-33408104 TACCCTTCCAGCAGCTTCCCTGG - Intronic
1165134679 19:33660344-33660366 TTTCCTTCCAAGAGCGGCGCAGG - Intronic
1165913751 19:39245398-39245420 TTTCCCTCCAGCTGCTCATCTGG - Intergenic
1165915525 19:39256701-39256723 TCTCCTGCCAGCACCTCCACTGG - Intergenic
1165917210 19:39268226-39268248 TTTCCCTCCAGCTGCTCATCTGG + Intergenic
928269497 2:29843406-29843428 TTTTCTTCCAGCAGTTGCACAGG - Intronic
932383721 2:71310830-71310852 TGTCCTTCCATCAGCTGAGCTGG + Intronic
933420905 2:82043815-82043837 TTTCATTCCTGCAGTTCAGCAGG - Intergenic
933769322 2:85733264-85733286 TATCCTTGCAGCTGCTCCGAAGG - Intergenic
935621801 2:105136520-105136542 GTTCCTTCCAGGAGCTCTGGGGG + Intergenic
935684679 2:105672894-105672916 TCTCATTCCACCAGCTCTGCGGG - Intergenic
937215116 2:120307715-120307737 TTCCCTGCCAGCAGCTCCTCTGG + Intergenic
938540354 2:132280040-132280062 GTTCCATGCAGCACCTCCGCCGG - Intergenic
944465213 2:199993804-199993826 TTTCCTTCCATCTCCTCTGCTGG - Intronic
944516286 2:200514872-200514894 TTTCCTTCCAGGAGAGCTGCAGG - Intronic
946416752 2:219543718-219543740 TTCCCCTCCAGCAGCTGCTCTGG + Exonic
946422957 2:219575231-219575253 TCTCCTTCCAGGAGCTGGGCTGG + Exonic
947013349 2:225590250-225590272 GGTCCTTCCAGCAGCTCAGGAGG + Intronic
948932301 2:241139792-241139814 TTCCCTACCAGGAGCTCTGCTGG - Intronic
1171854237 20:30330312-30330334 TTACCTTCAAGAAGCTCAGCAGG - Intergenic
1172910461 20:38405384-38405406 TTTCCCTCCAGCTGCTCCTCTGG + Intergenic
1173280390 20:41621708-41621730 TTTCATTCCAGCAGCTGCTGTGG - Intergenic
1176249749 20:64114882-64114904 TTTGCTCCCAGCACCTCTGCTGG + Intergenic
1178734584 21:35137271-35137293 TTTGCATCCAGGGGCTCCGCTGG - Intronic
1180988501 22:19919588-19919610 TATCCTTCCAGCCGCCCAGCTGG - Exonic
1181042586 22:20199240-20199262 CTTCCTTCCAGGAGCTCTGCTGG - Intergenic
1182354809 22:29718017-29718039 TTTCCTGCCAGCCTCTCAGCAGG + Intergenic
1183347259 22:37314747-37314769 TTTCCCTCCAGGGGCTCCCCTGG - Exonic
1185040023 22:48499070-48499092 AGCCTTTCCAGCAGCTCCGCCGG - Intronic
949862874 3:8522387-8522409 ATTCCTCCTATCAGCTCCGCAGG - Intronic
950266261 3:11575410-11575432 ACTCCCTCCAGCAGCTCAGCTGG + Intronic
956885716 3:73557146-73557168 TGTCCTCCCAGCAGCTGCACAGG + Intronic
959952770 3:112199144-112199166 TTTCCTTCCTGCAGCCCAGGTGG - Intronic
960155546 3:114294137-114294159 TTTCCTCCCTGCTGCTCTGCTGG - Intronic
961545493 3:127629968-127629990 TTTCCATTCAGCAGCCACGCCGG + Intronic
962172867 3:133121073-133121095 TCTGCTTTCAGCAGCTCTGCAGG + Intronic
962281855 3:134058046-134058068 TTTACCTTCAGCAGCTCAGCTGG - Intergenic
968135078 3:196215159-196215181 CTTCCTCCCAGCATCTCCGCAGG - Intronic
969235039 4:5859690-5859712 TTCCCATCCAGCAGATCCACGGG + Intronic
969718995 4:8882738-8882760 CTGCCTTCCAGCAGCTCTGGAGG - Intergenic
969746792 4:9079034-9079056 TCTCCTTCCAGCGCTTCCGCTGG + Intergenic
971688820 4:29806072-29806094 GTACATTTCAGCAGCTCCGCAGG + Intergenic
971707357 4:30063402-30063424 TTTGCTTCCAGCTGCTACCCAGG - Intergenic
977804673 4:101282724-101282746 TTTACTTCCTGCATCTCAGCAGG - Intronic
981237979 4:142440407-142440429 TTTCATTCCTGCTGCTCCGTTGG - Intronic
987868544 5:23579082-23579104 TTTCCTTCCAGTACCTCCTTGGG - Intergenic
988640139 5:33032783-33032805 TTTCCTTCTAGCATTTCCCCAGG + Intergenic
990980382 5:61597679-61597701 GTTCCTTCCAGAAGCTCTGAGGG + Intergenic
994040657 5:95256270-95256292 CTTTCTTCCAGCACCTCCTCAGG - Intronic
995128744 5:108607547-108607569 TTTCCTGACAGCAGCGCCCCAGG - Intergenic
997744068 5:136283402-136283424 TTCACTTCCAGCAACTCTGCTGG - Intronic
999704675 5:154261537-154261559 TTTTCTTCCACCAGCTAAGCAGG + Intronic
1001580372 5:172794111-172794133 TTTCCTTCCAGCAGCCGCCACGG + Intergenic
1002280072 5:178124659-178124681 ATCCCTTCCAGCAGCTCCCTGGG + Exonic
1002534237 5:179867484-179867506 GTCCCTTCCAGCATCTCCTCTGG - Exonic
1006628009 6:35411196-35411218 CTTCCTTCCAGCAGCTACACAGG + Exonic
1006934043 6:37705281-37705303 TTTCTCCCCGGCAGCTCCGCGGG + Intergenic
1007758140 6:44114201-44114223 TTTCCTCCCACCAGCACCACTGG - Exonic
1008226344 6:48921217-48921239 TTTCCTTCCACCATATCCCCAGG + Intergenic
1016729953 6:147418435-147418457 ATTCATTTCAGCAGCTCCACGGG + Intergenic
1017035643 6:150264642-150264664 TTCCTTTCCAGCAGCTGAGCAGG - Intergenic
1018026320 6:159809074-159809096 TTTCCTTCCAACAGCTCTCTCGG - Exonic
1019355599 7:577257-577279 TTTCTTTCCAGCAGCCCCCAGGG + Intronic
1019460165 7:1154004-1154026 TGTCCTCCCAGCAGCACCTCCGG - Intronic
1022259785 7:28692938-28692960 TTTCCTTCCTGTACCTGCGCTGG + Intronic
1022773558 7:33500855-33500877 TTTCCTGCAAGCAGCTCCCTGGG + Intronic
1023095893 7:36659404-36659426 TTACCATCCAGCAGCTCCCCGGG - Intronic
1031844690 7:126790941-126790963 TTTCCTACCAACTGCCCCGCAGG - Intronic
1031985246 7:128160233-128160255 TTGCCTTCCAGGAGCTCAGAGGG + Intergenic
1032805799 7:135353152-135353174 TTGGCTTCCAGTACCTCCGCTGG + Intergenic
1034845737 7:154442913-154442935 TTTCCTCTAAGCAGCTCCCCTGG + Intronic
1037294668 8:17387404-17387426 TTTTCTACCAGTAGCTCCCCTGG - Intronic
1040902470 8:52430840-52430862 TTTTCTTTCAGCAGCTTGGCTGG - Intronic
1040981590 8:53251077-53251099 TTTCGCTCCCGCAGCGCCGCAGG - Exonic
1041109534 8:54471533-54471555 TTTCCTTTAAGCAGCTCCATGGG + Intergenic
1041169447 8:55126355-55126377 TTTACTTCCAGCAGCTCTACTGG - Intronic
1044725905 8:95193998-95194020 ATTCCTTCCAGAGGCTCCGGGGG - Intergenic
1045327261 8:101126568-101126590 TTTCCCTCCAGGAGCCGCGCTGG + Intergenic
1046752472 8:117940291-117940313 TTTTCTTCCACCTGCTCCCCTGG - Intronic
1047169626 8:122479229-122479251 CTCCCTTCCAGCAGCTCTGCTGG + Intergenic
1049653560 8:143787982-143788004 TCTCCAGCCAGCAGCTCCTCGGG + Intergenic
1049705765 8:144041271-144041293 TTGCCTTCCAGCTGGACCGCAGG + Exonic
1053596500 9:39566999-39567021 CTTCCTTCCTGCTGCTCCACAGG + Intergenic
1053854465 9:42323639-42323661 CTTCCTTCCTGCTGCTCCACAGG + Intergenic
1054457132 9:65438824-65438846 TTTCCTTCCACCAGTACCCCAGG - Intergenic
1054569759 9:66798019-66798041 CTTCCTTCCTGCTGCTCCACAGG - Intergenic
1057783816 9:98072019-98072041 TTTCCTTCCCTCTGCTCCCCAGG + Intronic
1057806339 9:98222437-98222459 GTTCCTTCCACCAGCTTTGCAGG - Intronic
1061490272 9:130940327-130940349 TTTCCTTCCAGGACAACCGCTGG + Intergenic
1062493893 9:136822523-136822545 TGTTCTTCCAGCACCTCCGCAGG + Intronic
1185818109 X:3175259-3175281 TGTCATTCCAGCTGCTCCGGTGG + Intergenic
1187138300 X:16569692-16569714 GTTTCTTCCAGCAGCTCCCCAGG - Intergenic
1190446539 X:50531149-50531171 TTTCCTCCCAGCAACACAGCTGG + Intergenic
1198267502 X:135022658-135022680 TTTCCCACCACCTGCTCCGCTGG - Intergenic
1198341229 X:135714639-135714661 TTTCATTCCAGCCACTCCGATGG + Intronic
1199238439 X:145517749-145517771 TTTCCTTTCAGGAACCCCGCAGG + Intergenic