ID: 910454865

View in Genome Browser
Species Human (GRCh38)
Location 1:87386750-87386772
Sequence GGGTGCAAGGATGCATGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910454865_910454872 14 Left 910454865 1:87386750-87386772 CCTCAACATGCATCCTTGCACCC No data
Right 910454872 1:87386787-87386809 ATTTTTATGGCTACAGAGCTGGG No data
910454865_910454871 13 Left 910454865 1:87386750-87386772 CCTCAACATGCATCCTTGCACCC No data
Right 910454871 1:87386786-87386808 CATTTTTATGGCTACAGAGCTGG No data
910454865_910454869 1 Left 910454865 1:87386750-87386772 CCTCAACATGCATCCTTGCACCC No data
Right 910454869 1:87386774-87386796 CTCTGACCTGCTCATTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910454865 Original CRISPR GGGTGCAAGGATGCATGTTG AGG (reversed) Intergenic
No off target data available for this crispr