ID: 910454869

View in Genome Browser
Species Human (GRCh38)
Location 1:87386774-87386796
Sequence CTCTGACCTGCTCATTTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910454864_910454869 28 Left 910454864 1:87386723-87386745 CCTGTCTTGCATTGCATTCTGTG No data
Right 910454869 1:87386774-87386796 CTCTGACCTGCTCATTTTTATGG No data
910454865_910454869 1 Left 910454865 1:87386750-87386772 CCTCAACATGCATCCTTGCACCC No data
Right 910454869 1:87386774-87386796 CTCTGACCTGCTCATTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910454869 Original CRISPR CTCTGACCTGCTCATTTTTA TGG Intergenic
No off target data available for this crispr