ID: 910454872

View in Genome Browser
Species Human (GRCh38)
Location 1:87386787-87386809
Sequence ATTTTTATGGCTACAGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910454865_910454872 14 Left 910454865 1:87386750-87386772 CCTCAACATGCATCCTTGCACCC No data
Right 910454872 1:87386787-87386809 ATTTTTATGGCTACAGAGCTGGG No data
910454868_910454872 -7 Left 910454868 1:87386771-87386793 CCTCTCTGACCTGCTCATTTTTA No data
Right 910454872 1:87386787-87386809 ATTTTTATGGCTACAGAGCTGGG No data
910454867_910454872 -6 Left 910454867 1:87386770-87386792 CCCTCTCTGACCTGCTCATTTTT No data
Right 910454872 1:87386787-87386809 ATTTTTATGGCTACAGAGCTGGG No data
910454866_910454872 1 Left 910454866 1:87386763-87386785 CCTTGCACCCTCTCTGACCTGCT No data
Right 910454872 1:87386787-87386809 ATTTTTATGGCTACAGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910454872 Original CRISPR ATTTTTATGGCTACAGAGCT GGG Intergenic
No off target data available for this crispr