ID: 910456879

View in Genome Browser
Species Human (GRCh38)
Location 1:87407116-87407138
Sequence CAAGCTATTTCCTCGTTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910456873_910456879 12 Left 910456873 1:87407081-87407103 CCAAAACATTCTGCTTAAACAAG No data
Right 910456879 1:87407116-87407138 CAAGCTATTTCCTCGTTGGGGGG No data
910456872_910456879 13 Left 910456872 1:87407080-87407102 CCCAAAACATTCTGCTTAAACAA No data
Right 910456879 1:87407116-87407138 CAAGCTATTTCCTCGTTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910456879 Original CRISPR CAAGCTATTTCCTCGTTGGG GGG Intergenic
No off target data available for this crispr