ID: 910457695

View in Genome Browser
Species Human (GRCh38)
Location 1:87414940-87414962
Sequence CTTTGAGAGGCGAAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910457688_910457695 11 Left 910457688 1:87414906-87414928 CCGGGTGTGGTGGCTCACACCTG 0: 4448
1: 21565
2: 68153
3: 144733
4: 196449
Right 910457695 1:87414940-87414962 CTTTGAGAGGCGAAGGTGGATGG No data
910457689_910457695 -8 Left 910457689 1:87414925-87414947 CCTGTAATCCCAGCACTTTGAGA 0: 10757
1: 300314
2: 262016
3: 147673
4: 132180
Right 910457695 1:87414940-87414962 CTTTGAGAGGCGAAGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910457695 Original CRISPR CTTTGAGAGGCGAAGGTGGA TGG Intergenic
No off target data available for this crispr