ID: 910458182

View in Genome Browser
Species Human (GRCh38)
Location 1:87420807-87420829
Sequence ACACCTTCATCTAGCCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910458182_910458188 6 Left 910458182 1:87420807-87420829 CCTTCAGGGCTAGATGAAGGTGT No data
Right 910458188 1:87420836-87420858 TGCTTTTTCTTCCATGGTGGGGG No data
910458182_910458185 3 Left 910458182 1:87420807-87420829 CCTTCAGGGCTAGATGAAGGTGT No data
Right 910458185 1:87420833-87420855 GCATGCTTTTTCTTCCATGGTGG No data
910458182_910458189 15 Left 910458182 1:87420807-87420829 CCTTCAGGGCTAGATGAAGGTGT No data
Right 910458189 1:87420845-87420867 TTCCATGGTGGGGGCAACATTGG No data
910458182_910458187 5 Left 910458182 1:87420807-87420829 CCTTCAGGGCTAGATGAAGGTGT No data
Right 910458187 1:87420835-87420857 ATGCTTTTTCTTCCATGGTGGGG No data
910458182_910458190 16 Left 910458182 1:87420807-87420829 CCTTCAGGGCTAGATGAAGGTGT No data
Right 910458190 1:87420846-87420868 TCCATGGTGGGGGCAACATTGGG No data
910458182_910458186 4 Left 910458182 1:87420807-87420829 CCTTCAGGGCTAGATGAAGGTGT No data
Right 910458186 1:87420834-87420856 CATGCTTTTTCTTCCATGGTGGG No data
910458182_910458184 0 Left 910458182 1:87420807-87420829 CCTTCAGGGCTAGATGAAGGTGT No data
Right 910458184 1:87420830-87420852 TTGGCATGCTTTTTCTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910458182 Original CRISPR ACACCTTCATCTAGCCCTGA AGG (reversed) Intergenic