ID: 910462812

View in Genome Browser
Species Human (GRCh38)
Location 1:87466866-87466888
Sequence GCTCAGGGCACAGTGAGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910462812_910462821 23 Left 910462812 1:87466866-87466888 CCTTCTCTCACTGTGCCCTGAGC No data
Right 910462821 1:87466912-87466934 TCAACAGATTTATGGGGGATGGG No data
910462812_910462820 22 Left 910462812 1:87466866-87466888 CCTTCTCTCACTGTGCCCTGAGC No data
Right 910462820 1:87466911-87466933 TTCAACAGATTTATGGGGGATGG No data
910462812_910462816 15 Left 910462812 1:87466866-87466888 CCTTCTCTCACTGTGCCCTGAGC No data
Right 910462816 1:87466904-87466926 CAGAAGTTTCAACAGATTTATGG No data
910462812_910462818 17 Left 910462812 1:87466866-87466888 CCTTCTCTCACTGTGCCCTGAGC No data
Right 910462818 1:87466906-87466928 GAAGTTTCAACAGATTTATGGGG No data
910462812_910462817 16 Left 910462812 1:87466866-87466888 CCTTCTCTCACTGTGCCCTGAGC No data
Right 910462817 1:87466905-87466927 AGAAGTTTCAACAGATTTATGGG No data
910462812_910462819 18 Left 910462812 1:87466866-87466888 CCTTCTCTCACTGTGCCCTGAGC No data
Right 910462819 1:87466907-87466929 AAGTTTCAACAGATTTATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910462812 Original CRISPR GCTCAGGGCACAGTGAGAGA AGG (reversed) Intergenic
No off target data available for this crispr