ID: 910462815

View in Genome Browser
Species Human (GRCh38)
Location 1:87466888-87466910
Sequence ACTTCTGCTGAAGAATTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910462815_910462821 1 Left 910462815 1:87466888-87466910 CCACTCAATTCTTCAGCAGAAGT No data
Right 910462821 1:87466912-87466934 TCAACAGATTTATGGGGGATGGG No data
910462815_910462819 -4 Left 910462815 1:87466888-87466910 CCACTCAATTCTTCAGCAGAAGT No data
Right 910462819 1:87466907-87466929 AAGTTTCAACAGATTTATGGGGG No data
910462815_910462820 0 Left 910462815 1:87466888-87466910 CCACTCAATTCTTCAGCAGAAGT No data
Right 910462820 1:87466911-87466933 TTCAACAGATTTATGGGGGATGG No data
910462815_910462817 -6 Left 910462815 1:87466888-87466910 CCACTCAATTCTTCAGCAGAAGT No data
Right 910462817 1:87466905-87466927 AGAAGTTTCAACAGATTTATGGG No data
910462815_910462816 -7 Left 910462815 1:87466888-87466910 CCACTCAATTCTTCAGCAGAAGT No data
Right 910462816 1:87466904-87466926 CAGAAGTTTCAACAGATTTATGG No data
910462815_910462818 -5 Left 910462815 1:87466888-87466910 CCACTCAATTCTTCAGCAGAAGT No data
Right 910462818 1:87466906-87466928 GAAGTTTCAACAGATTTATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910462815 Original CRISPR ACTTCTGCTGAAGAATTGAG TGG (reversed) Intergenic
No off target data available for this crispr