ID: 910462819

View in Genome Browser
Species Human (GRCh38)
Location 1:87466907-87466929
Sequence AAGTTTCAACAGATTTATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910462812_910462819 18 Left 910462812 1:87466866-87466888 CCTTCTCTCACTGTGCCCTGAGC No data
Right 910462819 1:87466907-87466929 AAGTTTCAACAGATTTATGGGGG No data
910462815_910462819 -4 Left 910462815 1:87466888-87466910 CCACTCAATTCTTCAGCAGAAGT No data
Right 910462819 1:87466907-87466929 AAGTTTCAACAGATTTATGGGGG No data
910462813_910462819 3 Left 910462813 1:87466881-87466903 CCCTGAGCCACTCAATTCTTCAG No data
Right 910462819 1:87466907-87466929 AAGTTTCAACAGATTTATGGGGG No data
910462814_910462819 2 Left 910462814 1:87466882-87466904 CCTGAGCCACTCAATTCTTCAGC No data
Right 910462819 1:87466907-87466929 AAGTTTCAACAGATTTATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910462819 Original CRISPR AAGTTTCAACAGATTTATGG GGG Intergenic
No off target data available for this crispr