ID: 910463357

View in Genome Browser
Species Human (GRCh38)
Location 1:87471162-87471184
Sequence CTGTGTTACCACTTGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910463349_910463357 2 Left 910463349 1:87471137-87471159 CCCTTGCCAGTGGAAGCCTGGGT No data
Right 910463357 1:87471162-87471184 CTGTGTTACCACTTGGAGAAGGG No data
910463350_910463357 1 Left 910463350 1:87471138-87471160 CCTTGCCAGTGGAAGCCTGGGTC No data
Right 910463357 1:87471162-87471184 CTGTGTTACCACTTGGAGAAGGG No data
910463351_910463357 -4 Left 910463351 1:87471143-87471165 CCAGTGGAAGCCTGGGTCCCTGT No data
Right 910463357 1:87471162-87471184 CTGTGTTACCACTTGGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910463357 Original CRISPR CTGTGTTACCACTTGGAGAA GGG Intergenic
No off target data available for this crispr