ID: 910466382

View in Genome Browser
Species Human (GRCh38)
Location 1:87504757-87504779
Sequence AGGTGCTCAAAAATATTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910466374_910466382 8 Left 910466374 1:87504726-87504748 CCTGTTATATCCCTAGTGCCTGG No data
Right 910466382 1:87504757-87504779 AGGTGCTCAAAAATATTTGTTGG No data
910466381_910466382 -10 Left 910466381 1:87504744-87504766 CCTGGTGCAGGGTAGGTGCTCAA No data
Right 910466382 1:87504757-87504779 AGGTGCTCAAAAATATTTGTTGG No data
910466378_910466382 -2 Left 910466378 1:87504736-87504758 CCCTAGTGCCTGGTGCAGGGTAG No data
Right 910466382 1:87504757-87504779 AGGTGCTCAAAAATATTTGTTGG No data
910466373_910466382 26 Left 910466373 1:87504708-87504730 CCAGAGACTTAATTTTTACCTGT No data
Right 910466382 1:87504757-87504779 AGGTGCTCAAAAATATTTGTTGG No data
910466379_910466382 -3 Left 910466379 1:87504737-87504759 CCTAGTGCCTGGTGCAGGGTAGG No data
Right 910466382 1:87504757-87504779 AGGTGCTCAAAAATATTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910466382 Original CRISPR AGGTGCTCAAAAATATTTGT TGG Intergenic
No off target data available for this crispr