ID: 910470341

View in Genome Browser
Species Human (GRCh38)
Location 1:87546526-87546548
Sequence TTTTGTCCTTCTCTTTAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910470332_910470341 19 Left 910470332 1:87546484-87546506 CCCTAACACTCTACAATCATCAG No data
Right 910470341 1:87546526-87546548 TTTTGTCCTTCTCTTTAGGGAGG No data
910470333_910470341 18 Left 910470333 1:87546485-87546507 CCTAACACTCTACAATCATCAGG No data
Right 910470341 1:87546526-87546548 TTTTGTCCTTCTCTTTAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910470341 Original CRISPR TTTTGTCCTTCTCTTTAGGG AGG Intergenic
No off target data available for this crispr