ID: 910470525

View in Genome Browser
Species Human (GRCh38)
Location 1:87547745-87547767
Sequence AGGGAGAGGACAGTGACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910470525_910470533 25 Left 910470525 1:87547745-87547767 CCCACAGTCACTGTCCTCTCCCT No data
Right 910470533 1:87547793-87547815 CATGCCACACAACTGCTGCTGGG No data
910470525_910470532 24 Left 910470525 1:87547745-87547767 CCCACAGTCACTGTCCTCTCCCT No data
Right 910470532 1:87547792-87547814 CCATGCCACACAACTGCTGCTGG No data
910470525_910470534 26 Left 910470525 1:87547745-87547767 CCCACAGTCACTGTCCTCTCCCT No data
Right 910470534 1:87547794-87547816 ATGCCACACAACTGCTGCTGGGG No data
910470525_910470535 27 Left 910470525 1:87547745-87547767 CCCACAGTCACTGTCCTCTCCCT No data
Right 910470535 1:87547795-87547817 TGCCACACAACTGCTGCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910470525 Original CRISPR AGGGAGAGGACAGTGACTGT GGG (reversed) Intergenic