ID: 910470526

View in Genome Browser
Species Human (GRCh38)
Location 1:87547746-87547768
Sequence GAGGGAGAGGACAGTGACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910470526_910470537 30 Left 910470526 1:87547746-87547768 CCACAGTCACTGTCCTCTCCCTC No data
Right 910470537 1:87547799-87547821 ACACAACTGCTGCTGGGGGATGG No data
910470526_910470534 25 Left 910470526 1:87547746-87547768 CCACAGTCACTGTCCTCTCCCTC No data
Right 910470534 1:87547794-87547816 ATGCCACACAACTGCTGCTGGGG No data
910470526_910470532 23 Left 910470526 1:87547746-87547768 CCACAGTCACTGTCCTCTCCCTC No data
Right 910470532 1:87547792-87547814 CCATGCCACACAACTGCTGCTGG No data
910470526_910470533 24 Left 910470526 1:87547746-87547768 CCACAGTCACTGTCCTCTCCCTC No data
Right 910470533 1:87547793-87547815 CATGCCACACAACTGCTGCTGGG No data
910470526_910470535 26 Left 910470526 1:87547746-87547768 CCACAGTCACTGTCCTCTCCCTC No data
Right 910470535 1:87547795-87547817 TGCCACACAACTGCTGCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910470526 Original CRISPR GAGGGAGAGGACAGTGACTG TGG (reversed) Intergenic
No off target data available for this crispr