ID: 910470527

View in Genome Browser
Species Human (GRCh38)
Location 1:87547759-87547781
Sequence TGTGTGCTTGGAAGAGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910470527_910470537 17 Left 910470527 1:87547759-87547781 CCTCTCCCTCTTCCAAGCACACA No data
Right 910470537 1:87547799-87547821 ACACAACTGCTGCTGGGGGATGG No data
910470527_910470541 28 Left 910470527 1:87547759-87547781 CCTCTCCCTCTTCCAAGCACACA No data
Right 910470541 1:87547810-87547832 GCTGGGGGATGGGGGAAGCGTGG No data
910470527_910470534 12 Left 910470527 1:87547759-87547781 CCTCTCCCTCTTCCAAGCACACA No data
Right 910470534 1:87547794-87547816 ATGCCACACAACTGCTGCTGGGG No data
910470527_910470532 10 Left 910470527 1:87547759-87547781 CCTCTCCCTCTTCCAAGCACACA No data
Right 910470532 1:87547792-87547814 CCATGCCACACAACTGCTGCTGG No data
910470527_910470538 18 Left 910470527 1:87547759-87547781 CCTCTCCCTCTTCCAAGCACACA No data
Right 910470538 1:87547800-87547822 CACAACTGCTGCTGGGGGATGGG No data
910470527_910470533 11 Left 910470527 1:87547759-87547781 CCTCTCCCTCTTCCAAGCACACA No data
Right 910470533 1:87547793-87547815 CATGCCACACAACTGCTGCTGGG No data
910470527_910470535 13 Left 910470527 1:87547759-87547781 CCTCTCCCTCTTCCAAGCACACA No data
Right 910470535 1:87547795-87547817 TGCCACACAACTGCTGCTGGGGG No data
910470527_910470540 20 Left 910470527 1:87547759-87547781 CCTCTCCCTCTTCCAAGCACACA No data
Right 910470540 1:87547802-87547824 CAACTGCTGCTGGGGGATGGGGG No data
910470527_910470539 19 Left 910470527 1:87547759-87547781 CCTCTCCCTCTTCCAAGCACACA No data
Right 910470539 1:87547801-87547823 ACAACTGCTGCTGGGGGATGGGG No data
910470527_910470542 29 Left 910470527 1:87547759-87547781 CCTCTCCCTCTTCCAAGCACACA No data
Right 910470542 1:87547811-87547833 CTGGGGGATGGGGGAAGCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910470527 Original CRISPR TGTGTGCTTGGAAGAGGGAG AGG (reversed) Intergenic