ID: 910470531

View in Genome Browser
Species Human (GRCh38)
Location 1:87547792-87547814
Sequence CCAGCAGCAGTTGTGTGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910470531_910470542 -4 Left 910470531 1:87547792-87547814 CCATGCCACACAACTGCTGCTGG No data
Right 910470542 1:87547811-87547833 CTGGGGGATGGGGGAAGCGTGGG No data
910470531_910470541 -5 Left 910470531 1:87547792-87547814 CCATGCCACACAACTGCTGCTGG No data
Right 910470541 1:87547810-87547832 GCTGGGGGATGGGGGAAGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910470531 Original CRISPR CCAGCAGCAGTTGTGTGGCA TGG (reversed) Intergenic
No off target data available for this crispr