ID: 910470533

View in Genome Browser
Species Human (GRCh38)
Location 1:87547793-87547815
Sequence CATGCCACACAACTGCTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910470530_910470533 -1 Left 910470530 1:87547771-87547793 CCAAGCACACAGATTCTCTCTCC No data
Right 910470533 1:87547793-87547815 CATGCCACACAACTGCTGCTGGG No data
910470525_910470533 25 Left 910470525 1:87547745-87547767 CCCACAGTCACTGTCCTCTCCCT No data
Right 910470533 1:87547793-87547815 CATGCCACACAACTGCTGCTGGG No data
910470527_910470533 11 Left 910470527 1:87547759-87547781 CCTCTCCCTCTTCCAAGCACACA No data
Right 910470533 1:87547793-87547815 CATGCCACACAACTGCTGCTGGG No data
910470528_910470533 6 Left 910470528 1:87547764-87547786 CCCTCTTCCAAGCACACAGATTC No data
Right 910470533 1:87547793-87547815 CATGCCACACAACTGCTGCTGGG No data
910470526_910470533 24 Left 910470526 1:87547746-87547768 CCACAGTCACTGTCCTCTCCCTC No data
Right 910470533 1:87547793-87547815 CATGCCACACAACTGCTGCTGGG No data
910470529_910470533 5 Left 910470529 1:87547765-87547787 CCTCTTCCAAGCACACAGATTCT No data
Right 910470533 1:87547793-87547815 CATGCCACACAACTGCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910470533 Original CRISPR CATGCCACACAACTGCTGCT GGG Intergenic
No off target data available for this crispr