ID: 910470533 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:87547793-87547815 |
Sequence | CATGCCACACAACTGCTGCT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 6 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
910470527_910470533 | 11 | Left | 910470527 | 1:87547759-87547781 | CCTCTCCCTCTTCCAAGCACACA | No data | ||
Right | 910470533 | 1:87547793-87547815 | CATGCCACACAACTGCTGCTGGG | No data | ||||
910470530_910470533 | -1 | Left | 910470530 | 1:87547771-87547793 | CCAAGCACACAGATTCTCTCTCC | No data | ||
Right | 910470533 | 1:87547793-87547815 | CATGCCACACAACTGCTGCTGGG | No data | ||||
910470529_910470533 | 5 | Left | 910470529 | 1:87547765-87547787 | CCTCTTCCAAGCACACAGATTCT | No data | ||
Right | 910470533 | 1:87547793-87547815 | CATGCCACACAACTGCTGCTGGG | No data | ||||
910470525_910470533 | 25 | Left | 910470525 | 1:87547745-87547767 | CCCACAGTCACTGTCCTCTCCCT | No data | ||
Right | 910470533 | 1:87547793-87547815 | CATGCCACACAACTGCTGCTGGG | No data | ||||
910470526_910470533 | 24 | Left | 910470526 | 1:87547746-87547768 | CCACAGTCACTGTCCTCTCCCTC | No data | ||
Right | 910470533 | 1:87547793-87547815 | CATGCCACACAACTGCTGCTGGG | No data | ||||
910470528_910470533 | 6 | Left | 910470528 | 1:87547764-87547786 | CCCTCTTCCAAGCACACAGATTC | No data | ||
Right | 910470533 | 1:87547793-87547815 | CATGCCACACAACTGCTGCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
910470533 | Original CRISPR | CATGCCACACAACTGCTGCT GGG | Intergenic | ||