ID: 910470535

View in Genome Browser
Species Human (GRCh38)
Location 1:87547795-87547817
Sequence TGCCACACAACTGCTGCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910470527_910470535 13 Left 910470527 1:87547759-87547781 CCTCTCCCTCTTCCAAGCACACA No data
Right 910470535 1:87547795-87547817 TGCCACACAACTGCTGCTGGGGG No data
910470528_910470535 8 Left 910470528 1:87547764-87547786 CCCTCTTCCAAGCACACAGATTC No data
Right 910470535 1:87547795-87547817 TGCCACACAACTGCTGCTGGGGG No data
910470529_910470535 7 Left 910470529 1:87547765-87547787 CCTCTTCCAAGCACACAGATTCT No data
Right 910470535 1:87547795-87547817 TGCCACACAACTGCTGCTGGGGG No data
910470526_910470535 26 Left 910470526 1:87547746-87547768 CCACAGTCACTGTCCTCTCCCTC No data
Right 910470535 1:87547795-87547817 TGCCACACAACTGCTGCTGGGGG No data
910470530_910470535 1 Left 910470530 1:87547771-87547793 CCAAGCACACAGATTCTCTCTCC No data
Right 910470535 1:87547795-87547817 TGCCACACAACTGCTGCTGGGGG No data
910470525_910470535 27 Left 910470525 1:87547745-87547767 CCCACAGTCACTGTCCTCTCCCT No data
Right 910470535 1:87547795-87547817 TGCCACACAACTGCTGCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910470535 Original CRISPR TGCCACACAACTGCTGCTGG GGG Intergenic
No off target data available for this crispr