ID: 910470536

View in Genome Browser
Species Human (GRCh38)
Location 1:87547797-87547819
Sequence ATCCCCCAGCAGCAGTTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910470536_910470542 -9 Left 910470536 1:87547797-87547819 CCACACAACTGCTGCTGGGGGAT No data
Right 910470542 1:87547811-87547833 CTGGGGGATGGGGGAAGCGTGGG No data
910470536_910470541 -10 Left 910470536 1:87547797-87547819 CCACACAACTGCTGCTGGGGGAT No data
Right 910470541 1:87547810-87547832 GCTGGGGGATGGGGGAAGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910470536 Original CRISPR ATCCCCCAGCAGCAGTTGTG TGG (reversed) Intergenic