ID: 910470538

View in Genome Browser
Species Human (GRCh38)
Location 1:87547800-87547822
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910470530_910470538 6 Left 910470530 1:87547771-87547793 CCAAGCACACAGATTCTCTCTCC No data
Right 910470538 1:87547800-87547822 CACAACTGCTGCTGGGGGATGGG No data
910470527_910470538 18 Left 910470527 1:87547759-87547781 CCTCTCCCTCTTCCAAGCACACA No data
Right 910470538 1:87547800-87547822 CACAACTGCTGCTGGGGGATGGG No data
910470529_910470538 12 Left 910470529 1:87547765-87547787 CCTCTTCCAAGCACACAGATTCT No data
Right 910470538 1:87547800-87547822 CACAACTGCTGCTGGGGGATGGG No data
910470528_910470538 13 Left 910470528 1:87547764-87547786 CCCTCTTCCAAGCACACAGATTC No data
Right 910470538 1:87547800-87547822 CACAACTGCTGCTGGGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr