ID: 910470540

View in Genome Browser
Species Human (GRCh38)
Location 1:87547802-87547824
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910470528_910470540 15 Left 910470528 1:87547764-87547786 CCCTCTTCCAAGCACACAGATTC No data
Right 910470540 1:87547802-87547824 CAACTGCTGCTGGGGGATGGGGG No data
910470527_910470540 20 Left 910470527 1:87547759-87547781 CCTCTCCCTCTTCCAAGCACACA No data
Right 910470540 1:87547802-87547824 CAACTGCTGCTGGGGGATGGGGG No data
910470530_910470540 8 Left 910470530 1:87547771-87547793 CCAAGCACACAGATTCTCTCTCC No data
Right 910470540 1:87547802-87547824 CAACTGCTGCTGGGGGATGGGGG No data
910470529_910470540 14 Left 910470529 1:87547765-87547787 CCTCTTCCAAGCACACAGATTCT No data
Right 910470540 1:87547802-87547824 CAACTGCTGCTGGGGGATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr