ID: 910470541

View in Genome Browser
Species Human (GRCh38)
Location 1:87547810-87547832
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910470527_910470541 28 Left 910470527 1:87547759-87547781 CCTCTCCCTCTTCCAAGCACACA No data
Right 910470541 1:87547810-87547832 GCTGGGGGATGGGGGAAGCGTGG No data
910470530_910470541 16 Left 910470530 1:87547771-87547793 CCAAGCACACAGATTCTCTCTCC No data
Right 910470541 1:87547810-87547832 GCTGGGGGATGGGGGAAGCGTGG No data
910470529_910470541 22 Left 910470529 1:87547765-87547787 CCTCTTCCAAGCACACAGATTCT No data
Right 910470541 1:87547810-87547832 GCTGGGGGATGGGGGAAGCGTGG No data
910470531_910470541 -5 Left 910470531 1:87547792-87547814 CCATGCCACACAACTGCTGCTGG No data
Right 910470541 1:87547810-87547832 GCTGGGGGATGGGGGAAGCGTGG No data
910470528_910470541 23 Left 910470528 1:87547764-87547786 CCCTCTTCCAAGCACACAGATTC No data
Right 910470541 1:87547810-87547832 GCTGGGGGATGGGGGAAGCGTGG No data
910470536_910470541 -10 Left 910470536 1:87547797-87547819 CCACACAACTGCTGCTGGGGGAT No data
Right 910470541 1:87547810-87547832 GCTGGGGGATGGGGGAAGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type