ID: 910472846

View in Genome Browser
Species Human (GRCh38)
Location 1:87573653-87573675
Sequence AGGACTGATGTCCTGACACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910472841_910472846 -5 Left 910472841 1:87573635-87573657 CCTCCACCACACTCCATGAGGAC No data
Right 910472846 1:87573653-87573675 AGGACTGATGTCCTGACACAGGG No data
910472839_910472846 21 Left 910472839 1:87573609-87573631 CCATGTGTTCTTGAATTGATCTT No data
Right 910472846 1:87573653-87573675 AGGACTGATGTCCTGACACAGGG No data
910472842_910472846 -8 Left 910472842 1:87573638-87573660 CCACCACACTCCATGAGGACTGA No data
Right 910472846 1:87573653-87573675 AGGACTGATGTCCTGACACAGGG No data
910472838_910472846 22 Left 910472838 1:87573608-87573630 CCCATGTGTTCTTGAATTGATCT No data
Right 910472846 1:87573653-87573675 AGGACTGATGTCCTGACACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910472846 Original CRISPR AGGACTGATGTCCTGACACA GGG Intergenic
No off target data available for this crispr