ID: 910475527

View in Genome Browser
Species Human (GRCh38)
Location 1:87602212-87602234
Sequence ATGTCCCAGTAGAACAACTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910475527_910475530 17 Left 910475527 1:87602212-87602234 CCATAGTTGTTCTACTGGGACAT No data
Right 910475530 1:87602252-87602274 CTAAACTGTGTCTTTCTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910475527 Original CRISPR ATGTCCCAGTAGAACAACTA TGG (reversed) Intergenic
No off target data available for this crispr