ID: 910480719 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:87655531-87655553 |
| Sequence | CTTTGGGTCTGGCAGTCACT CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 910480719_910480726 | -4 | Left | 910480719 | 1:87655531-87655553 | CCGAGTGACTGCCAGACCCAAAG | No data | ||
| Right | 910480726 | 1:87655550-87655572 | AAAGGGAACAGCTATCACGTGGG | No data | ||||
| 910480719_910480725 | -5 | Left | 910480719 | 1:87655531-87655553 | CCGAGTGACTGCCAGACCCAAAG | No data | ||
| Right | 910480725 | 1:87655549-87655571 | CAAAGGGAACAGCTATCACGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 910480719 | Original CRISPR | CTTTGGGTCTGGCAGTCACT CGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||