ID: 910480719

View in Genome Browser
Species Human (GRCh38)
Location 1:87655531-87655553
Sequence CTTTGGGTCTGGCAGTCACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910480719_910480726 -4 Left 910480719 1:87655531-87655553 CCGAGTGACTGCCAGACCCAAAG No data
Right 910480726 1:87655550-87655572 AAAGGGAACAGCTATCACGTGGG No data
910480719_910480725 -5 Left 910480719 1:87655531-87655553 CCGAGTGACTGCCAGACCCAAAG No data
Right 910480725 1:87655549-87655571 CAAAGGGAACAGCTATCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910480719 Original CRISPR CTTTGGGTCTGGCAGTCACT CGG (reversed) Intergenic
No off target data available for this crispr