ID: 910482531

View in Genome Browser
Species Human (GRCh38)
Location 1:87674226-87674248
Sequence CCTTGGGAGGAGTAGATGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910482521_910482531 12 Left 910482521 1:87674191-87674213 CCTATAAAGTGGGGGTACAACGA No data
Right 910482531 1:87674226-87674248 CCTTGGGAGGAGTAGATGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910482531 Original CRISPR CCTTGGGAGGAGTAGATGAA AGG Intergenic
No off target data available for this crispr