ID: 910485272

View in Genome Browser
Species Human (GRCh38)
Location 1:87706220-87706242
Sequence AGGCTGAGCCAACTCTAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910485272_910485275 23 Left 910485272 1:87706220-87706242 CCAATCTAGAGTTGGCTCAGCCT No data
Right 910485275 1:87706266-87706288 GTTGTTCTTTCTCATCCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910485272 Original CRISPR AGGCTGAGCCAACTCTAGAT TGG (reversed) Intergenic
No off target data available for this crispr