ID: 910485674

View in Genome Browser
Species Human (GRCh38)
Location 1:87710930-87710952
Sequence GGGGCTGTCAAGACAGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910485674_910485679 14 Left 910485674 1:87710930-87710952 CCTGGCTCTGTCTTGACAGCCCC No data
Right 910485679 1:87710967-87710989 GCAACCACACTTTTCTCTGCTGG No data
910485674_910485680 15 Left 910485674 1:87710930-87710952 CCTGGCTCTGTCTTGACAGCCCC No data
Right 910485680 1:87710968-87710990 CAACCACACTTTTCTCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910485674 Original CRISPR GGGGCTGTCAAGACAGAGCC AGG (reversed) Intergenic