ID: 910488421

View in Genome Browser
Species Human (GRCh38)
Location 1:87741677-87741699
Sequence CTCTATGTAAAGCTGGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910488421_910488427 22 Left 910488421 1:87741677-87741699 CCAAGCTCCAGCTTTACATAGAG No data
Right 910488427 1:87741722-87741744 GCTAACTTTCAAAAGAAGCTGGG No data
910488421_910488429 28 Left 910488421 1:87741677-87741699 CCAAGCTCCAGCTTTACATAGAG No data
Right 910488429 1:87741728-87741750 TTTCAAAAGAAGCTGGGGTAAGG No data
910488421_910488426 21 Left 910488421 1:87741677-87741699 CCAAGCTCCAGCTTTACATAGAG No data
Right 910488426 1:87741721-87741743 AGCTAACTTTCAAAAGAAGCTGG No data
910488421_910488424 -3 Left 910488421 1:87741677-87741699 CCAAGCTCCAGCTTTACATAGAG No data
Right 910488424 1:87741697-87741719 GAGATACCATGGCAGTAATAAGG No data
910488421_910488428 23 Left 910488421 1:87741677-87741699 CCAAGCTCCAGCTTTACATAGAG No data
Right 910488428 1:87741723-87741745 CTAACTTTCAAAAGAAGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910488421 Original CRISPR CTCTATGTAAAGCTGGAGCT TGG (reversed) Intergenic
No off target data available for this crispr