ID: 910488685

View in Genome Browser
Species Human (GRCh38)
Location 1:87744525-87744547
Sequence ATGTCTTTTTGTGATTACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910488685_910488694 16 Left 910488685 1:87744525-87744547 CCTTTGTAATCACAAAAAGACAT No data
Right 910488694 1:87744564-87744586 TGGGTAATCACACACATCAAGGG No data
910488685_910488695 17 Left 910488685 1:87744525-87744547 CCTTTGTAATCACAAAAAGACAT No data
Right 910488695 1:87744565-87744587 GGGTAATCACACACATCAAGGGG No data
910488685_910488690 -4 Left 910488685 1:87744525-87744547 CCTTTGTAATCACAAAAAGACAT No data
Right 910488690 1:87744544-87744566 ACATGGAAGCCAGGGGTTTTTGG No data
910488685_910488691 -3 Left 910488685 1:87744525-87744547 CCTTTGTAATCACAAAAAGACAT No data
Right 910488691 1:87744545-87744567 CATGGAAGCCAGGGGTTTTTGGG No data
910488685_910488693 15 Left 910488685 1:87744525-87744547 CCTTTGTAATCACAAAAAGACAT No data
Right 910488693 1:87744563-87744585 TTGGGTAATCACACACATCAAGG No data
910488685_910488697 27 Left 910488685 1:87744525-87744547 CCTTTGTAATCACAAAAAGACAT No data
Right 910488697 1:87744575-87744597 ACACATCAAGGGGCATTAAAGGG No data
910488685_910488696 26 Left 910488685 1:87744525-87744547 CCTTTGTAATCACAAAAAGACAT No data
Right 910488696 1:87744574-87744596 CACACATCAAGGGGCATTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910488685 Original CRISPR ATGTCTTTTTGTGATTACAA AGG (reversed) Intergenic
No off target data available for this crispr