ID: 910488693

View in Genome Browser
Species Human (GRCh38)
Location 1:87744563-87744585
Sequence TTGGGTAATCACACACATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910488685_910488693 15 Left 910488685 1:87744525-87744547 CCTTTGTAATCACAAAAAGACAT No data
Right 910488693 1:87744563-87744585 TTGGGTAATCACACACATCAAGG No data
910488684_910488693 18 Left 910488684 1:87744522-87744544 CCTCCTTTGTAATCACAAAAAGA No data
Right 910488693 1:87744563-87744585 TTGGGTAATCACACACATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910488693 Original CRISPR TTGGGTAATCACACACATCA AGG Intergenic
No off target data available for this crispr