ID: 910491848

View in Genome Browser
Species Human (GRCh38)
Location 1:87781307-87781329
Sequence TCATCTCTACTGGTTGCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910491848_910491854 24 Left 910491848 1:87781307-87781329 CCATGAGCAACCAGTAGAGATGA No data
Right 910491854 1:87781354-87781376 GGCCCTACAGATCAGATGCCTGG No data
910491848_910491852 -8 Left 910491848 1:87781307-87781329 CCATGAGCAACCAGTAGAGATGA No data
Right 910491852 1:87781322-87781344 AGAGATGAACTGATGGGTACTGG No data
910491848_910491853 3 Left 910491848 1:87781307-87781329 CCATGAGCAACCAGTAGAGATGA No data
Right 910491853 1:87781333-87781355 GATGGGTACTGGCTGAATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910491848 Original CRISPR TCATCTCTACTGGTTGCTCA TGG (reversed) Intergenic