ID: 910492623

View in Genome Browser
Species Human (GRCh38)
Location 1:87789216-87789238
Sequence CCTGATAATCAAAGAGTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910492623_910492626 25 Left 910492623 1:87789216-87789238 CCTTTCACTCTTTGATTATCAGG No data
Right 910492626 1:87789264-87789286 ACTTTCAATGTTGTATATTAAGG No data
910492623_910492627 26 Left 910492623 1:87789216-87789238 CCTTTCACTCTTTGATTATCAGG No data
Right 910492627 1:87789265-87789287 CTTTCAATGTTGTATATTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910492623 Original CRISPR CCTGATAATCAAAGAGTGAA AGG (reversed) Intergenic
No off target data available for this crispr