ID: 910492626

View in Genome Browser
Species Human (GRCh38)
Location 1:87789264-87789286
Sequence ACTTTCAATGTTGTATATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910492622_910492626 26 Left 910492622 1:87789215-87789237 CCCTTTCACTCTTTGATTATCAG No data
Right 910492626 1:87789264-87789286 ACTTTCAATGTTGTATATTAAGG No data
910492623_910492626 25 Left 910492623 1:87789216-87789238 CCTTTCACTCTTTGATTATCAGG No data
Right 910492626 1:87789264-87789286 ACTTTCAATGTTGTATATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910492626 Original CRISPR ACTTTCAATGTTGTATATTA AGG Intergenic
No off target data available for this crispr