ID: 910492627 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:87789265-87789287 |
Sequence | CTTTCAATGTTGTATATTAA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
910492622_910492627 | 27 | Left | 910492622 | 1:87789215-87789237 | CCCTTTCACTCTTTGATTATCAG | No data | ||
Right | 910492627 | 1:87789265-87789287 | CTTTCAATGTTGTATATTAAGGG | No data | ||||
910492623_910492627 | 26 | Left | 910492623 | 1:87789216-87789238 | CCTTTCACTCTTTGATTATCAGG | No data | ||
Right | 910492627 | 1:87789265-87789287 | CTTTCAATGTTGTATATTAAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
910492627 | Original CRISPR | CTTTCAATGTTGTATATTAA GGG | Intergenic | ||
No off target data available for this crispr |