ID: 910492670

View in Genome Browser
Species Human (GRCh38)
Location 1:87789732-87789754
Sequence GAGCTAAGACTGGCATAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910492665_910492670 14 Left 910492665 1:87789695-87789717 CCACACCTGCTCTGACCTTCTCA No data
Right 910492670 1:87789732-87789754 GAGCTAAGACTGGCATAGACTGG No data
910492663_910492670 27 Left 910492663 1:87789682-87789704 CCTAGAAATCTTCCCACACCTGC No data
Right 910492670 1:87789732-87789754 GAGCTAAGACTGGCATAGACTGG No data
910492664_910492670 15 Left 910492664 1:87789694-87789716 CCCACACCTGCTCTGACCTTCTC No data
Right 910492670 1:87789732-87789754 GAGCTAAGACTGGCATAGACTGG No data
910492667_910492670 -1 Left 910492667 1:87789710-87789732 CCTTCTCAAGAGTGACTTTCCAG No data
Right 910492670 1:87789732-87789754 GAGCTAAGACTGGCATAGACTGG No data
910492666_910492670 9 Left 910492666 1:87789700-87789722 CCTGCTCTGACCTTCTCAAGAGT No data
Right 910492670 1:87789732-87789754 GAGCTAAGACTGGCATAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910492670 Original CRISPR GAGCTAAGACTGGCATAGAC TGG Intergenic
No off target data available for this crispr