ID: 910493163

View in Genome Browser
Species Human (GRCh38)
Location 1:87795392-87795414
Sequence CTGGAGGCTCAGAACCAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910493163_910493170 21 Left 910493163 1:87795392-87795414 CCTTGCTGGTTCTGAGCCTCCAG No data
Right 910493170 1:87795436-87795458 TTCCAAAATGATTTGTCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910493163 Original CRISPR CTGGAGGCTCAGAACCAGCA AGG (reversed) Intergenic
No off target data available for this crispr