ID: 910496388

View in Genome Browser
Species Human (GRCh38)
Location 1:87833462-87833484
Sequence ATGAAAAATACGGGGGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910496379_910496388 24 Left 910496379 1:87833415-87833437 CCAATATCAGTCACTGAAGAGGA No data
Right 910496388 1:87833462-87833484 ATGAAAAATACGGGGGTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910496388 Original CRISPR ATGAAAAATACGGGGGTGGG GGG Intergenic
No off target data available for this crispr